Description :
From Genome Similarity Track
Location :
Scaffold_3033:287- 2683
Sequence
2396 bases(100 bases per row)
CTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCC
GGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACACACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCG
GCTCCCGAACGTGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGCCCGGCGATCCCCCGCAGGTACAGGCTCG
CGACCTCTCGCTCCACCAGGCCGGGCGGCCCGCAAGGCGAGCGAGCTCGCCCTGATTCCCGGCCTGGGTGGCAGCATCACCGCCAGTCCCAAGGCCAAGT
GCAATCTCAAGCATGAGGACACGTTGACGGAGGCAGTCAACCTCAGGGCCCTGTGTTGGACCCGCAATCGGAGCACTCGGACGAGAGTGGCTTTCGGGAG
GCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTGCATTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGC
GTCGCGGTAAGCGACAGCTTCTCGTGAAGTGGAGGGATTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTTATTGACTGCCCGAAGGC
TGTCGCAATCTGGGAGCAGAAGCGGCGGCAGCTTCATAAGTAGTCCGAGGCTTCTTGCCCGAACGGGGTATGGACGATGAATACATTCCGTACCCGCGCT
CATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCTTTGACAGCATACGCTTGCAGACCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAG
AATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGTGTACTTAAGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGTACTC
CACGTGGGACAGTTCTCGAGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACATGTCGTGAAGTTCTTAA
GGGGAATGCGGTGTGGCGCGAGAAGCACACGCCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCT
AGAAGTGTAGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTG
ATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCC
CCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCACTTCATCCGCGGAGTCGAAGATACTCTGGTAGGGAGCGACGAGTCT
CCTTCTCCTCGCGGAGTGGAGACCTAGAGGCTGTACGCTTCTTTGAGGGCTTGGACGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCAGCAA
GCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGG
ACTGTGATCACCTTGATCACTAGCGAGTGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTTCCCTCCCACAGAGCCCGCAGGAGCATCA
TGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGATCTCACGTTCTACGAACCGAGGGCTCGGACGATTGTCTGAAGATGAGGGCGACGGAC
TGCGGCGCTTGCCTGCTCGCTAGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCAGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCC
GTGAGGCTTAGTGCTCTTGGCGTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACGGTCGAA
TTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGACTCTAACTGTGAAGTGAGCCTCCGCCGCGAAGATCCATCCGGATCCTGACTCGACACTC
CACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCG
AAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAAGATCGCCCCTAAGAAAGAG