Description :
From Genome Similarity Track
Location :
Scaffold_3174:287- 2191
Sequence
1904 bases(100 bases per row)
CCCGTCACACCTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGACCCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCC
ATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCT
CGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGGAGCAAACCCGCCTCACCCG
AAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGA
TCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGCGCTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTT
CACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCTAACTACGAGTACCGCCAGCGTTCGCGCTCTCCTCGCGTGTAAACAAGG
AAGACGCGAACTGCCCCCAGTTATGTGCTAGAGAATATGGGGAGCTCACGCGGTTCTCTAGTGGGAAAACCCACTCCAATGTAACACACTAGAATGTACT
GTGTTTCATGTGACGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAA
GAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCTCAACGGACCAGTTCCCATGG
AACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTC
CTTCCTCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAG
AACTAAGTCTTCGTGATGGGTGCGCGGGTGGTGCGTACCACGTACCACGGACGTAGCCCTTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGC
GGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTCAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGG
TTGCTCGTAACAGCAACAAGTTGTTCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCC
CAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATG
CCTTGGGCTTGAGAAGCACGAGCCCTAGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGTAGTCCGACAGAGCATTGGTGAGTCATGTT
CCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGATGCCAAAGCATTTGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGG
ATGTTTCGATGGTGGCAGCGCCCAGAAGATGCGCTGGCCAAGTGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTT
CGTAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTTACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACAAAGTGCCACACGCG
GTCG