Description :
From Genome Similarity Track
Location :
Scaffold_2893:287- 1565
Transcript NameFunction/comments
Phyra_87942taurine dioxygenase, putative

Sequence
1278 bases(100 bases per row)
GCATGTGGCTCAGTCCTGTCATTGGCGTGCGTGGTTAAAGCCGCCCTGGATCGCGTCCATCTTGACGGCGTGTGTTGAGTGTTTGGAGCACTTTGCACGG
GCTTCCTTTCAGCACTTACGAAAATCGCGTTGCTCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCCATCAACATCGACTCCACCTCCACCACTGCCG
GACCCACTGCCGCGGTGGTAGTCACACCAATCAAGAACGCGCTCAACCAAGAGGTCGAACATGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCC
CACCAAGACGTACGATCCGATCCCCGTGCTGCCGTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACG
CACCTGGAGCCGAAGATTGGCACGGAGATCTCGGGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCG
GCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGATCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGC
GAAGAGTATCCCGCAGGTGCACGTGGTGGAGAACTCACTCGAAGTTAGCGAGAAGCGTATCAAGTCGCAACTGTATGATCATGTGAATGTGTGGCACAGT
GATGTGTCCTATGAGCGCCAGGTGAAGAAGTTTGGGGGGGGGGGGGTATGTTCTGTACATGTTTAGTATATTAACTTGTGTGACTTGTAGCCTCCATCCT
ACACGAGTTTCAAGGTCTTGACTACACCACCCACGGGTGGAGACACGCTGTGGGCGTCTGCGTACGACGCGTACGAGCGTCTTACCCCACAATTCCAGAA
ATTTGTGGAGGGTCTCACCGCTATCCACAGCAGCAAGGTACGAGATGCTCTTTGACACGTATGCAAATGTCTTTGGATGGAGCCTCATTCTTTGCATGTG
AACTGATACAGAGCCAAGCCGAGAGCGCAATCGCCAAAGGTCAGACCCTTCGCCGCCCTATCGTGGAGTTCGAACACCCGGTTGTTCGCACGCACCCGGT
GACGGGCCGCAAGGCATTATACGTGAACAGCCAGTTCACGACTCGCATCAACAACTTGTCTGCTCCCGAGTCCGGTACGTTCAGTGCGTCGTGTTCATGA
TATCGATGCCAGTGTGCTGATAGCTCTGTGTTGGTCCTTCAGACGCGGTCTTGCGTTTTCTGCTCCAGCACATCGCAC