Description :
From Genome Similarity Track
Location :
scaffold_5:286903- 288384
Sequence
1481 bases(100 bases per row)
AGCTTGAACTGCAGTAGCACCATGACAATGCGTAAGGACGGCTCCTTTTCACCCGCAAGGTGATAGTAAAGCGTAGCTCGCTCTGGCGAAATGAACGACA
CCCCGAGACCATGCTCGTGCATGTACCCCACACTGAAAAGCGCTCGCGCGCTTGTGCCAGCACTCACCAGGTCTGCATGTTGATAGTGCCTTAGCGCAAC
AGTATAGTCTTCATCTTGGTAAGCACTGTCACCCATACGCAACAGCGCGTCAATGCTGTCTTGCTCAAAGGCACGATTCACAAGTCGAGCATATAAGCGT
TCAAGCAGCTTTGAGTCACGGATAGAGGGAGTGCCAAATACTTGTCGCTGAACACGTTCAATCAGCCAGACAGCATTGTTCTGCGCGACTTCATAACCCA
TTTCAGCAGCAATCAAGTACAGCTCCAGCGCTAGCGCCCAGTTGCCTCGTTGCGCGTGGGTCAGCGCTTGTGTCATCAATGTTGTTCCTTCTCGTGAGTA
TTCGGCCACGCGCTTATAGAGCTCAACAACTTCTTGACACGATGTACTGCTCGTGGTTGCACCTCCAATGGTGTGAATCTGCCGCTGCTTGAGTCGAGCA
AGCTGGAAAAGCGACTTGAGATGGCCAACGTGTGCCGCCGCAACGAGATACTCTTTTGCCCGTGACGAAAGGTGAGACCCGAGCTCCAAGAAAGACATGC
CCGTATTGTAGACACCTTCGGCATGACCTGCGTTAGCTGCAACTTTGAAAAGGTTGCGAGCTCTGTCAGGATCGACAGGCATGTCACCAATGCCGCGCGA
GAAAATAACACCGAGGCCATTTGCTGCTTCACCGCTAGGATTTCCTTCCGATGCGTTCAATGCAGCTTCGTAGAGCTCTACAGCTCGTGAGGCGTTGGAT
TTGCACCCTGCAAGTCCGTAGGCGTACACGTGACCGAGAAGAGCCTGAGCCTTGATGCTGCCCATTTCAATTGAGCGCTCCAGAAATCGTAGTGCCTCAC
GTTCACGAGCAGCGTGTTCTTCAAGATCAGACATAGCTGTAACACCGTACAGGTCGCTGAACAAGGTGATGCTAGCCGACTGAACCATCACGTCGGTGTT
GCGGAGGTCAGCAGCACGCTGTCTAAGATACTCAGCTCTGTTGAAGTCTTCTGCCGGGTTGAGATCGCCATGATATCGGGCACCCTCGGTCTCGGAAAGC
CTTGCAGGTTCAGGAAAGGCATACAGCTGAAGCTTCTGGTCATTCTGCTGGGTAACGACTCGATCCGCGGCGAGCTTGTAGTGCCTCATAGCTGCCGTAC
AGGACTTCCTTGAGCCGTAGCCGTGTAAGGCGCGATAACCAAGCGCCATGGAAGCACCGATCGATTGTCCACGAGTAGCAAACGCGTAGTATAATTGAGC
ACCTGCACTGTCATCAGAGGCAGCTCGCAGAGCACCTAGGAGGAACTGTGCTTGGGAACTGCCGTGCCCAGCACTAGCTTG