Description :
From Genome Similarity Track
Location :
Scaffold_311:2869- 6357
Sequence
3488 bases(100 bases per row)
GTTGGGAGAAACTTTCGTCAAGAGGCGTGCAAACTCACTTGACGTTGCTGGATCAGTATGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTC
CGTTACGTTGTTGCGTTTTCGCAACAACGTCCGACCCACGCCTTGGACCTCACTTGGACGCTTGGCGGTTACTGTATCATGCAGTACGTGGTACCGCGCT
GGGGGAACCGCATTCATATGCGTAATACCCTGTCTTCTAATATCTATTGCATTTCTGCAATTTCTTGTAGTTGTTAACACGAGAGCTCTCGCTCTCACGT
TAAAGAGTTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGACAGACGATAGGAATTCGAATTCGCGTGATCCTGTTTCACGCTGAAGTCCTCCTG
TTCCGCAATCTTATTGCCTCTTCAAGGGTGTTGAACTCCAATTGGAACAGGTAGGTTTGAACAGGACCATCAGTCAGACCCTGTATGAACAACGTAATCA
ACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTAAATGTACGAGTGTACATCACGTTTACCTTGCTTGATTCTAAG
GAGCTCAGAGCGAGCCCTGAACTCTGCTCGAGGCAGCTCAAAAGTTTGCCTTCGCAGGGACTTGAAGGCTTCCAACGACCCAAAGACATATGGGTCGTGT
AACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTACCAAGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACTAACCCTTATGG
CATCGTCTAGTTCCACGAACCATCTCAATAGTGAGTCTTCATCGGCTCCCTTGTACTTTGAGATGTCAATCTTTAGAGTATCGGATCGACGTGTATACTT
CGACCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGTTCAAACTGTTGAGCATTATGTTCTCTCAACAGCTCTGTCTTTTGAGAACCTTGTTGGTGAAGC
AAGGTTACTTTTTACCGCTCGGCGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCTGGCCCCAAAGCGGACAGCAGTGCGCCAA
CGGCTTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGTGTCCCATTCGATTTGACTCAAATGGGAGTAGCTCTCATGCGTGGGATGAAAATCATCCCC
CTCATCGTCCAACACATTTATGGTCGTTGAACGAACTACGAAGTGCTACCAGGTGTAACAGGGCACACCTTATTCAAGTAACTGAATAAACCTTGCACTG
CTGACAGTGAAAGGGCGTGTGCTTCCGACTACCTCACGTACACGTACGTGCGGAGGAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTA
GAACTGTATTTAGTATAGTTAATCCTTGTAACAAATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAACATGTATTATAACTATCTGCGCGCCAC
TCGTTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTTGATCCTATATCAATCAATGAGCAGTGTGTTACATCCGCGGGGCAATATTATCTA
TTAGGATAATATTGTGACAATATTGTGTTTGTCCCAACGCAATATTCGTACTTGATGTTTACCTTATGTAAATTATCATGCAACGGGGGCACCCCGTTAC
AAAAGTGCTCCAATGGCGCCCAAGATGACGCCTTTCCAGGAGCAGCATGCGCTGGTGTTCGGACTCGAGCTCATCAAGACGGAAATGGGCGGCGCGCAAA
CTGTGCGATGCGTGTTCTGCATCTATGACAGCCGTGACAGGTTGAGGTTGGAAGCTCAACTGGTCGCAAGTGTAAGTCGCGCGTTGACATCAATACTACA
CGAAACCGTTCGCGCCGCAGAACTATCGCAGTCACGATGAGACCCAGCATAGCAAGTCCTGGGCAGAGTAAAGCGAGCTGTATAACGCGGAGAAGCGCGA
ATACTTCACTGGGAAGACGGAGATCGTGAACACGTTGTATAACTATATTGAAGTTGAAGGCAACACTATGGAATTCAAAGTTCCGCCGCGAGACCATCAT
CGGCGACATGTTCTTCAGAAACGACGAAATGCTGGACGTCGAAGACGATGATGAAGACAACCTCGTGGCGTCTGAAGCAGCAAAGGCAGTAGCCAAGAAA
ATCGCCAAGAATTCCAGCGAGAAGGCGCATGCGATGAAGCTGTTCGTCAAGGCCTCGGACAATGAGAAGTACATCATCACTATCAAGAATGTGATTCGTT
ACGAACTCGCATTGGACCACGTGGGAAGCGGCATGTCATTCAGGCAGGCGACCATGTCAATCGAACACTCCAAGCGACGTACGCAAACGCCGAATCTCGC
AGGCATTAACGGTTTGATGGTCGGCCAGTTCATTCACGCCCTTATCGCGTCAAACTTGTAACGAATTGAGGACTTCATGGGTGACGCGTCCGTCTGGGCA
TTTTCTTTCGTGTGTGATGGCAGCACGCATCACGGCCAGTCGTTCTTTGATATGCGTTTGCGATTCTGCTACCGCGGCGTCCTGGTCAACTTGCACCTCG
TCGCCATCCCAATGTTCGACAAGCATACATCGCAGATCACATTTGATACGTTCCGCAAGTTTATAGACGCGTTGTACGAATCGTGGTGTGGCAAATTGAT
TTGCGTCGCTTCAGAAGGCGAGAACGCAATGACTGGCCGCCATGCCGGCTTGGTCACTCGATTGTGCGCTGCAGCTGAGCATCCTGTCCTTCGCATTTGG
TGCGCGCCTCGTCAAAAATTGCTTTGGATTTGAAGCACTCGTCCGTGTGTTCCAAGGCGAATGGATCGCCAAAGCGCATGCTTTCAGCGTCTTCCTGCGT
GATTAGAACAGCTTGATCAACGAGATGAATGTCAAGTGCCCGAAGCTGACTACTCGCTGGGTCCAGTATGGCATCGTGCTGATCGTTTTCATCATATACC
GAAGAAGACTGGTCAACTACGGAGCTGATCATCAGAAGTTCGTCCGCCGTCGCCGTTCTGGTGTATCATGACGTACGCTGCGTCTCCTGCCATTAGCAGT
GTCAACAAGACAATTGTAGTACTGCAGGACAAGGCGCTCCTGATAGCGCAGCAGGACGAGCACATTGTCAATTTAATTGGATCGCTTGTCGCGATGTTCA
GCATTGACTCGACTGATGGGCCGATGGACGGCTATTTTGTTAACGGTGGCATACGCATCGCCTATGCGGACATTGTCGCTCACATCGAGGACCAGGGATC
GTGGCCAACGCAGCTATTGGCGGCGCTGAGCAACGACGAGAAGGTAGATGTCTTACGCGAGGTCACTACCTACGCGATGAACCTGGTGCTCGGCCTGCAG
AGCGTGCGAGCAGAGCGCGACGCCAACAATCTGCCTCGCACGCAAGATCCACCGCCGGTAATGCCTGCGCAGCTCGTCAAGCTGTCGC