Description :
From Genome Similarity Track
Location :
Scaffold_1432:2868- 8493
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1432-snap-gene-0.2Tyrosine aminotransferase

Sequence
5625 bases(100 bases per row)
TGGTGCGTCCGCCTGTTTGTGGATGAATGTCGTCAAATGTGTTGGTGCTCACATGCCACTCTTCATTATGTAGAGCGCGGTTCCGGACCTTCTCACACCG
ACACCGGGCAGTGCCGAAGAGGCGTCGCTCGAAGAGTTCAAGCTCAACTACTACGACACGCTCGAGCGGAACTCGAAGTTCACGACCGACGCCCTGAGCA
AAATCCCTGGCCTGAAGGTCGTTGTGCCGCAAGGCGCCATGTACGTCATGGTCGAAGTGGACACAACTGTTCTCACCGGCATCAAGGACGACTTCGACTT
CACCCAGAAGCTCCTCGATGAAGAATCCGTGTTTGTGCTTCCAGGCCAGGTATGTAACCACCTTCAACTTCCATATGTGCAGATATGGTCCATTTGCTAA
TGTATTTTGTGCATCCATCTCAGTGCTTTGGTATGGAGAACTACTTCCGCATCGTCTTCTCTGCGCCGCACGAAGTGCTCGACGATGCCTACACACGCAT
CGCCGAGTTCTGCAAACGCCACAGCCAGTAGAGCCTCCCCACACTGGGCCATTCATCAGAATGGCTGCCTTTTCACTTTGGGTATATTTGCAATTTACAG
ATCCTGTTGAGTCCTTTATCGTGAATGTTTCAGCCATCTTTCCCCGTCCTGATTTATGGGTGCACCTTTTTGTCCAATCATAACAGAGTCCTACACCCAC
CATGTAACCCATATCGAAAATTAGTTGGAGTTTTTTCTCAGCACCAGTCGGCACTCTCCGCAACGCCTGGAGAAGTTGGCGCTGTCACAACTTCTGTGTC
GACGCCAAGGAAGGACTCTCCTCATTGACGCTCGGGTCTCGCCACCACAGATTACTTCCCCATATTAGAGATGCGGTGGGTTTCGTCACTGGCTGCGCTC
GCTGCGCTCTGCTGCGCAACGTCGGTCGCGCCGACGACCGCTCAATCGAATGGCGCGATCATCGTGCGCGGCAACAAGCTGTACAATGAGAAAACGGGCG
AGCGATTCTTCATGAAAGGCGTACGTCTGTATTACTACGGAATGACCCCTCCAGTGTGGCTTATCGTATGGTGCGCTGTAGATGACGTACGAGTACGCGG
TGAGCGACAAGTATTACACACAGTACTCAAAGGCGGCGATCGCCGAGAACCTCAAAGGACTCAAATTCAACGCGTTGCGCGTGTACAACATCAACCCGGA
TGAGTCATATGGGCTGTTCATGAAGGACATGGAAGCGCTGGGCGTGTATGTGCTCATCGCCGCGTCGCCGGACAACTCGGACTACTTTGGCAAGTACAAG
TATGCGACGATGCGGAAGGATCTTCCACCCGAGGCAACCGACGGCGACACGTGCTATCCTGCTCTGCTATTGGAGTACGGCAAGAAGGTGCGCATGCTTG
CTGTTGTCGTCTGCTTTGTCATTACGAATGCGAAACTGAAACGTGTATTTGCTTGGTGACGTTTTCAGATCGCACTGAACTTTGCGCAGTACGACAACAC
CTTGGGCATGATCCTTGCGAATGAGATCATGCAAGGCAGTCTGATGGCCGGTGCCTGTGTCAAGCAATATGCTGCTGACTTGAAGGGCTGGATGCGCGCG
AACAGCAAGAGCATGCGGATGATTCCGCTCGCGTATGCCGCGGCCGATAGCTCGTACGACAACCCGAAGCTGACAAGCACCGTGCTCCAAGCTGAAGAAT
ACCACACCGTGAAGATTCAAGGTCTGCTGTGTGGCGACAGCATGAAGGATGGCATGATGCAAAAGAGTATCGACATCTACCTGATTAACGAGTACCGTTG
GTGCGATGACGTGACCTATGACGCGACCTACGCCAAGTTCCTCGAGATGGTCAGCGGGCTTCCGATCGTGCTTGCCTTTGGCGAGTACGGTTGCCACAAC
ACACCATTTACGACCCCGCGCAAATGGCCGATGGTCCCATACTTGTACCAGTCGCCGACGCTGACGAAGGGCTTTACGAATGTCTGGTCTGGTGGTCTCG
CGTACTCGTACGGTGAAGCCAAGCTTGACCTCAACTCGGGATTCCCCATGTTCAAAGGTGCGACTGGGTGTGTCTCAGGGTTTCGAATTGCGGATACTGA
TGATGTGTTCCTCACGTAGGTGGCTCGCTTGACCCACTATCCACGCCGAGCAATGAACCCACGACGGATTACACCAACTTGAAAGCCCAGTTTGCGAAAT
ACTCGCCGTACAGTGACCCTGCGGACTGGACCAAGGATACCAAATGCACGTGGGCACCGACCGTCACTGAGTCGATTAGCTCTACCAACACACGCGCAAC
CAAGAGTGGCTGGTTGATCAAGAGTTGTTCCTCCAGCGACCTCAAGATTGCCCCCTCAGACACCTGGGTGGCCAAGCCGCGTCAGGGGGCACCGTGCGAT
GACAAGGGCAACCCGTGTGAAGTCAAAGTGTCCTCCGCGTTGGACACCACGCAGGAGACCATTTGCGGTGGTAAAATGCCGACTGCGTCGGCGGACAGCG
GCGGCGGCGGTAACTGCAGCTCCTCGGCCGACTGTGGCTTGAACGGGCAGTGCCTGAAAGTGAACGGCACGAACGCGTGCTCGTGCCTCGCTTGTTGGAC
CGGCTCAGATTGCAGCATCAAGGACACGGTAGCTTGCACGGCACTCAGCAGCAGCAAGGCCGCCCCCAAGATCGTGTTTGCACTCGTCGGTGTTTTCCTC
GGTGTCATGCTGGTCACATTCATTGCGCTTGCGATTGTGGCGGCAAAGAAGAAAAGTGGTAAGTTGGGAGCTGGCGGACGATTGCATTTCCGAATGATGA
TGCTGATAGAACGTGCTTGTTGATACCCATAGCGATCGACCGCCTCGCTGACCAAGTCAAGCTTCGTGGTCCAACAGCGGCGGCTGGGTCCACTCAAGAG
GTCTCACTGTAGAAAGCAGTGTCATGGATGGATCTGCAAGACACGTTCACTGACTGCAGTGCATTCGTGGAGTTTCGCCTACACCACACTCTTTATTATC
CTCGAGCCGAGTTCACTTGCAGTCAATCTTGCTGAACTTCATGCGAAAGTCCACATCGCATAGGTCTCATTCTTTGCCCTAAACCTAAAATTTATTTTAA
GCCAATCATACGCCGATAATTTCCGACCATCTCAAGTTTTCGGGCGTTTTTTGTATCATGTGGGGAAAACGCAGAAAGCCAGGGGGTACGTGAGTCTGTC
GGCCAATATTGGACGATCGGGTGACATTTGGTGAACGGCCATCGCGCGCGCTATCCATAGCGGACGGACTGGAGAGGAGAAGAGAATGGCACGCTTGTTG
TCGTCGCTGGCGACTGTCGCGGCGCTGTGCTGCGCGGCCGCGTGGGCGCCGCTGCGCACAGAGGCCGCCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNTT
GTGCGCGGCAACAAAATGTACAACGAGAAGACGGGCGTACGCTTCATGATCAAGGGCGTACGTAGAGAGAACGACCTAACGAAACGGATTATGCGACTTG
GTTTACTGATGCGCGTATGTGGTGTGGTGTGGTAGATGACCTACGAGTACGCGGTGAGCGACAGCTATTACACCAAGTACTCCAAGGACGTGATCGCCAA
GAACCTCAAGGGTCTCGAGTTCAACACGCTTCGTGTGTACAACATCAACCCGGAAGAGTCCTATGCGCTGTTTATGAAAGACATGGCTGCGCTCGGTGTG
TACGTCATGGTCGCTGCGTCGCCGGATAACTCGGAGTACTTTGGCAAGTACCGATTCGCGCCGATCCGGAAGGATCTTCCACCCGAGTCGAGCACGGGCG
AGACGTGTTACCCGGCGTTGCTCTTAGAGTACGGAAAGAAGGTATGCAAGCATCTCTCCATGATCACGTGGGTATGCCATATATCGAGATGGAGAACTCA
CCGCCATACTGTATATTCGTACTTGTAGATTGCCCAAAACTTTGCCCAGTACGACAATACCCTCGCCATGATCATCGCGAACGAGATCATGCAAACGGAT
CTGAAAGCAGCAGCGTGCGTCAAGCAATACGCGGCTGATCTCAAGAACTGGATGCGCACGAACGGCAAGATGATGCGCATCCTTCCGCTCTCGTACGCGG
CCGCAGATAGTGCATTTAACAACGCCAAGCTCTCTCCCACCGTTCTCGAACCAGAGGAGTATCACAGCGTCAAAATTCAAGGCCTTCTGTGCGGTGATAC
CATGAAGGACGGGATGATGCTCAAGAGCATTGATATTTATCTCATCAACGAGTACCGGTGGTGTGAGAAGGCCACGTATGAAGGAACTTACGCGAGGTTT
CTCGAGGTCGTCAAGGGTCTCCCCATTGTCGTGGCCTTCGGCGAGTACGGCTGCCGTGGTGCGAAGGGCGTCATCCGAACGTGGCCCATGGTCCCATACT
TGTACCAGACCCCGGCTTTGACCAAGGGGTTCACGAACGTCTTCTCTGGTGGGCTCGCATACTCGTACGGCCAAGCCAAGCTGTCTGCTGACTCGGAGTA
CCCCATGTTCACTGGTGCGTGCTCGTGTATATTGGAGACTCGGTATCATTTCTCACGTTTCCTTCTCGATCAGGTGGCTCGCTTGATCCATTGTTGACCC
CGTCGCAAACGGCCACGCCGGACTACGGCAACTTGAAGACTGCGTTCGCGAAGTATCAGCCCTACAGCGACCCCGCCGGGTGGACGGATGATACAAAGTG
CACGTGGGCGCCTACGATTACAGAGAAGATTAGTTCCACGAACACTCGCGTCACTGCGAATGGATGGATTCTCGACTCCTGCACAGCAAGCGCGCTAAAG
ATCGCGCCCTCAGACACGTGGGTTGCGAAGTCGCGGCAGGGGGCTGCCTGTAACAGCAACGGCGCGGCATGTGAAGTCACCATTGCCTCTCCCATTGGCA
CGACCCAAGAGAGCATTTGCGGTGGTGTTTACAAGGTTGAAGCGGGTGGTGGCAAGTGCAAGACATCGGTCGACTGTGGACCGAATGGCCAGTGCCTTGC
CGTGGATGGTGTGAACCAGTGCAGCTGTCTGTCGTGTTGGTCGGGGAGCGACTGTAGCGTGCGAGACACGGTGTCGTGCAGCAAACTGACGAGCAGCAAG
ACCGCGCCAAAGATCATTTTCGCCGGCGTTGGTGCCTTCCTGGTCGTGTCGTTCTTCGTGTTCGTCTCGATTGGGTTTGCTGCCCAGAAGAAGAGAAAAG
GTGAGTCGTCGTGGCTTGCATCTTTAGTGGAGGAATCGTGCTGACGATCCGTCTTTCCCATTCCATTAGTCATGCAGCGCCACATTGATCAAGTCAAGCT
TCGTGCGCCAGTGGAGGGCTCCGTGCAGACTCCCACGCCCATGTAGCTCAGTCAAAATTGCTCCAGAAAGTGCAACATCGGTTAACCAAAGATTAACCTA
AAGTACAGTATCTGCTTTCTTAAGTACTGTAAACGGGGGTCGTTGCGTGCCTTTGGGACAGAGGCCGAAACAGTTGGTGTCCACTCGAGCAACGTCACGG
AGCAGGAGCCATGCCGCCGAAGAAGAAGGAGGTGCGTGGTCATGACGAAGGGGGGAACCCCCAGGGCACGAGAGGCTGACAGGCAGTGGCTCTTTGGTGC
TTACCACCCGCAGGAAGCGCCGCCC