Description :
From Genome Similarity Track
Location :
Scaffold_23:286792- 289843
Transcript NameFunction/comments
Hyaar_Emoy2803828hypothetical protein

Sequence
3051 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTCGATAATGGAGACTTTTCTCGCCTGACAGGTCATTCACAAGCCTT
TCTGGTAATACCCAAGGCTTGTGTTCAGAGAATAGAAGCAGCACATGCCGTCTAGAGCCTCCTGCATGGTACAACGTAAGTCTTTGTACACTAGAGTCGT
CATCACGACGGTGCAAATCATCACCGCATTCGCTAGAAGGCGAATGCGCAGTAGCAGGCGCGGAGGATGAGTCAGCATGCTCATCCTCCTAACTAAATAG
ACTCCAGTAGTGACTATGAGTCTGACTAAACGCTCGAGTACTACTCGTAATCTCGTATTCGGCCGCATCTATAGACTCGGGTGACCTAGGTGTTTTCTTC
GAGTCAGACCCACCGTCCGACTCCCCCGAATAGATAAGCTCCACTTGGGAGCCATCATCATTAGCACGTGGTGTCTCACCACGTGCGTCTACCGCAACTG
GTGCTGCAGAAAGAGTTGCAGCGGCAGCAGACGAAGCATTGTCTGCCGCGAAAGTCTGGACATCCCTTAGAGCAGCTGCGTTAATACGCGCATCGCATGG
AGTTGTTCACCGTGCGATGAAAATCCAAAAATGAATGGATCTGACCAAAACAAGTTCTCCCTTCCTAGCAGTCCAATCAACGATGGACGCGCGCAATGAG
TGGTGAGCAAGACTTTAGCATCATTTTCATAGATAATTGTAATGAAGTTAGGACTAAAACATAGGTTAATGATTAGGACTTCATTATATTTAATACAGCT
TTGCTTTAAATAAGAACTAGTGAGATCCTAGTTACTATCCCTTCCTCTGCCGAGTTAACAGAGGCAGCAAGTCACCACTCACGCTGATGTTGGTGATAGT
AGCTCCACACTGTTGTCCTGTGTGTTTCTCCCGTGCCCCATTACAGGCGACGTGCTCTCGAGCATGTGAACGGCTAGATGGCGCCTTTTAAAAGAAGGCA
CCTATAGATTCAACTTGGTCGCGGGGGACTGGCCACTGCCGGGTAACACAGTACTTGGAACCCAGCACAAGATCGATCTCGTGCGGTACTCTTTCAGTGA
AAGGGTAGCCAGACTAGGTTTTAGGGAGACGTCAGCAAATACTCGCGCAAG