Description :
From Genome Similarity Track
Location :
contig_61:28675- 41335
Transcript NameFunction/comments
g11326.t1hypothetical protein
g11327.t1hypothetical protein

Sequence
12660 bases(100 bases per row)
GATCGGATCTAGGAATCTCTTTGCATGACAAGCGCCACACCAGCCAATATCCACTTCGCCTTGGGATGGATCGTGTTCAGTGTAGCAAGGAACACGTACG
TCGGTCCTCGAAGTGTTGTCTGATATACAGGACAATCAAACACGTCCTTGCTACGTCGGAAGTGCCCCACTGCCGTGGCCTCCCATTTGCTGTCAATCAC
CACAGCTCGCGCATAGATTACAGGTGCAGCTGGAAGCAATTCCTTTGGCATCGGATCCACTAGATGCCCGCCACAAGGAATAGAGTCGACCTCGTATATA
AACGGCGACGTTTTGTCGCCGTCTTTCATGGGATATTCCCACCGCGCGCCCTCCATGAACAGACCATGAATGTACGCACCCATTTCAGGATAAGATTCGG
CCCCCTCAGCATCGGCAATGGGTGTAACATGAGTCTCAATCGCCATGGAGTCCAGTGGGATTCCGTGTGTTCGCGCCGTGCACTGCTTGATTGCAGTGAG
GAAAGCTGTTGGATTGAACAAGCCCGAGATCCACATCGAGTAAGGAAGGCGGAACTCGTTTGTCCAGCTTGAAAGAAACTGGCCACGCTCCAGTAGATCG
GCAAACCACAACGATAGCGACTTCGCGACCACCACGCGTATCTCTCCCAGGAGCACATGTGCAACACATTACGACCAGGGACTTGGTTGATTGAAAGCGC
CTCCATGAGGTCCTCCATCTGCTCTGTCATGTTCAGCGTGCCCTGAATTCCTTTCGTGAGCTCGACGAGACTGGTTTGAATCTCGTGGAGTAGTGTGTGC
ATGCGAGTAGCTTCTTGCAAAGCGACTACAACGTAAGGAGATTGATCGGTTGTCAGCAATGGATCTGCCTTGGCTTGCAAGTCTGCAAGATCAATCTCTG
GTGGAAGCTTCTCAAGCAACTCTTCGATAACGGCATAGACGTGAGCATTTTCTTTTGCCAACTCAGATGCTGCACTCCGTGCAGTCTTAGTCGCTGTGCC
ATCAGCAGACGTGGATGGTCCTCCTGATGGCTGGAATTTTGCAATTGCCGCGAATAGTTCATTGGAGGCGTCCACGAGGTATCCTACCTCCGCGTTCGGA
TGCAATCCGTACACCGTTGGGGATTCACTCGGCAGCTGTGTTTCGATATGGTCGACGTACTTGGTATAACTAAAAGTAAACGGGTCGGGACACTTAAACC
CAGCAGTGAGTTCTTTGCCGTGGAAAATGTCTTTTGTAAAGACTTCGTTCAGGTAGGTGTTGTTCGTAATCCGGTCCCAGTGATCCGTGATATGGCCACC
ATACATAATTTCTCCAAAGATGTAGCGCAGATCGTCCCATGGCAAGCTCTTCGATCTACTCGTTGCCGCAGTATCAAGGTACCGTCGAAGTACATCCGAG
CAGATAAGTAAGTCCCCCGTGTTGAAGCTGTACGGCCGACTCCAACCTTGGCAGCCAAACCTCCGCCGTCCTAACACCAGCGCATGGAAGAAGCATAAGG
CGAAGATACATCCTTGGTATTCGCTGGGCTGAGCACAAGCGTCAAGCTGCTTCAGCGAAAAGTTAGCCCAGGCTCGACGCAAATTACTCTTCAAGTCAGT
CGGCGCCTCATTTGCAACCTTGATGCAGCTTTGTAGAAGCGACTCTGGAAGATTACTGAGTGAGGCCAAAGCTGGGCCCTCGGATGAGAGAAAACACCGG
AAATTCTGATCTGCAGATACAGAGTAAACTTCCAAAGTTCTCTCTAACCTCGGGAGCCATGACTGCATCAAATGGATGTTCTGAAGAATCACCCAATTTC
CTTCTCGAGAGAACTTCATGAGCACACTGTCAGCGTATTCCTCCTGGCCTTGACCCATAGAAATGTTGATAAGATTTCCCCGCTCGTATGTGAAATCAAA
CTTTTTGCCAAGCGTCTCCACCCACGAGGTCGGGTCCACACCAGGAAATAGCACGAAAAACATCGGCGTTGAGGCACTCGTTTCTTGGTAAGCCGCCTCC
ATGTCAAAGGGTGGCTGCTGAACCATCTGCTTACCAAACGTATCACTTAGATACGAGCGCAGAGCAAAGATCATTCGATCTGGCCGGAGCACGCGTACGA
TGTGCAGCAACTGGACTGGCGTGACCGAGGTTTTGTATTGTCCGGGGAGAGGTTTCACTTCGGGCTTTTCAGCATCACACCATTCTCGCCATTCCTCACT
ATCGGAGCGCATAAACGTTGTGAGCTTCTGGAGGCTGTGTATATTTCCTCGAGTTTCCGAACGCGAAGCCACATTGTTTCAGACATCCACTCGCTAAGAA
GTCCCATCCCTGACCCCATGTCACTTGCAGTACTGCAGGTCACTAACTGATGAACGTCGATCGCATCGATTTTCTTTTCCGACTGCAAAATCGAAAAACA
CAGTTGAGTGGCCAAAGTCAACTTGTCCTTCTCAAAGAGCCCCCGACGTATATAGTTGAATACCACGTCAGTAATGGATGCATTAAGCTGCGTACACCGG
GCCTCGATTTGTGCTGTTGAAGGCTTTTCTTCCTGGTCCGTTTCCTTCATGAGGACGTCTAAATCTTGTTCGGTGTTAGTGTCCATCACCCGATCCGCCA
GGAGCAAATCCGAATTCCACTGAAAGCGTTGCGATACAATAACCTTTTTTGCCGCTGCCTTCAACCGACTAAGCAAACCTCCGCCACCCGATGAAGGCGG
TCTTCCAGGATCCTTCTCGGGTTGAACCAAGTCAATTCCACGCTGAAAAATGACGACGTACGCGTTCAAAGAGTACACATAGTATGAGTGCATACGATGC
AAACCATCCATGATGAAAAAGAGCAGTGCCCCCCGACTTGCCACAGATTGATACTTCGCGCTCAGCTCATTAATTTGAGCTTCGTACTCGGTGGCTTTGG
CGGCTTTCTTTGCGATTTCTTGTGAAGTAGCCTTTGTCGTTTCCAAGTCCGTGATTACCTGCACATTCTCCGTCACATCCCCCTCGGCATCGGCAAGACT
CGAAAGAATACGATCTTCCAGCGTTTGTATCCGGATTTTAAACTCGTTCTGTTGGTGAATGAGAGCTGTACGAACTTTAGCCATTTTAGGCCACTCCTTG
CGCACTACGAGAGCCAAAAGCTGGTCTTCAAGGCCTTGTTGCGTAACAGCAAAATTAATCATCGTAGTCTCGGCTTGCAGCTCAGGTGGGTAGTGAGGAT
TCGACAGCTTTGTATGCAAATACAGTCGGAATTCAGGATGTAGTTCGACAAGTTTATCACCCATTTTCAGTAGGGTTTTGCGGCCTCGTACGGTGGTAGA
CCGAGAGATCACGGGCCACATACACACCTCCAGTTTCTCTCCCATATTTTCAACTATCACTGTGTAACCGTGCTCGACTGCAGTCTCCAACAGTTGAGTC
AAGTTTGGTTGATCTTGACGTACTCTGCAGGGAGCTAGGTGCCGCCCGTCGTGCATGCTTCTCCATTTCACGAAGCCAATAAATACCTTGCAGTTGTGGG
TCGATTAGTAGTGGTGACCGAGTACTGTTGCGCACTATGGCACCATTTTCGACCGAAACGCGATCGCTTGGAAGCCCTTTCGTATTCCATTCTGCAATCT
CTGAAGGCGTTGCAAGAATTTGTAAAGGATTACCATCTTCTGACATTGTGCTTATTGCAGGTGCAGCCTTATCCTTATCTTTGTCAGCTTTAGGTGGCTT
TTCAGTCAGCGCTTTACGAAGGAAAGGCAGCCACTTGTCGTTGATAAGCAAATCTCGGAATGGCTTTGTGAAAGCGCCAACGTACGAAACAAAGCTAGCA
GCTATCACAACGTCACAGACCAACATTTCGGCACTTACGCGAAGCTGCTCAAGTTCATGTGCCCAGCGTTCACTCTCACTTCCGAGAGCCTTTGCTAATC
GACGAGCAAGTTCCATACGAAGGCGACCCCTCTCCAGCAATCCCACTGCGTCCTGGACCTCCTTATTTGTCTTGTCAAATTCTTCTGTCAATATGTCAAG
CTTCTCCTCCAGCGCCGCTACCTTTTGATTCACCAACTCCAGCCTCTCGTTCGCGACCCGTAGTTTTTCGTTAGCCTCTTCTAATGCTCGCTTTTTGGGC
TCAACCACCACAATGGCATCGTAATAAGCCACGATATTGATTACCCAGGCACACAACCCAGCAGAGGCAGAGTTTTTCTTCTCAATTGCCTCCACATTGA
AGTGTTCAAGCAGTAAAAACGGACGGATTTCCTTCCAGTTGACCTCAGGTATTTGCTGGTTATCCACCAGCGTCTTGAATCCTTTAAGTTCGTCGACTAA
CGAGTTAATGTTTCCCAGCAGCGCTTTCTTCGTGGCCTCCCATGATCGATCCTTGTCTTTCACCTTGCCATTTTTCTGGATGATCACATTTGGATTCACG
CCAGCAAAGAGCACGACTACAGCGCCGAAAACGTCGCCTACACCTGCAGGAGGCTTCGCCATTGTCTTGCAGTTTCCCAGATCCTTTTTATTTAGCGTGT
CTAAAGCCGCCATCGCAGCCTCCACCATAGGCTCGGCTTGAGCAAGATCCGCCTCGGTGTCCGCCTTCTTTGCAGATACATCAGTCTGGATAATAGCGCA
CTTCTCGCGCTCAACGTTTGCTTTTGCTGTCTCGTTTTCAACAAGCTCCTTGTCTTTTTGAAGACGTGCTGCTAACTCTTCAACAATAACCTTCTTGTTC
TCTGCTTCTTCTAGCGTACGTTTCAACTCTTCCTCCATGGTTGCAACGATTTCTCCTGTTGATTCCATCTTCTCAAGTCCGCTTTGAAGGCGTTGCATCG
CGTTTTGGTGTCTGGAGTGCTTCTGGGCTAGTAGCCGACGATACAGTGTCAAACATTCCAGATATGACTTCGGAGTCGAGTATACGCGACGCTTTTCACG
TGCGAAAAACTCACTTGCTAATGTGTTTGTACTCTGAAAAGCGAATGGCATGAAATTTTGCACCGCCATCGCCACATTTTCTGCGGGACTCAACTGTGGA
ATGTTATCAAAGGAAAGGAAGCGCGCAGCAACAGACCGCAGCGCTTCCTTAGGCCATGGCTGAAACCAGTCGATCAACGCACAGTTCACTAGGGCAGGGA
ACTTTCGAGCTTGCATTCGGAAGTCTGCCGTTGCCGGAGAGAAACAGAGGACAACATGTAGGTTGCGCTTAATTTCCTGGACAAGCCATCGCCATGCACG
CTCTTTTTCAGACCCTTCGGTTCCAAGATTGATAGCTTCATTACCATCGCCAGACGAATCTGCCGCGGCACTTGCTGCTAGCGCTGCCACCATCTTCGGC
TGGAATTGCTGAATCAAATTGGTCTGCTCGTCAGCATTGTAAAGATCTGGTATATTACCACTCGACAGCAAGTCGTTCAGATACACGAGCATTCGCTCAT
TCTTAATTTGATTGTCGTCAAACAGGAAAACTAATCCGTCACCTTTGACACCTGCTTTCATGAACATGTTCTGAAGATCGGATTTGAAGTCCAACAGTGA
ATACGCTTGCGTAATTGTGATCTCCACCAGAGCGTATCCACAGATGAATGTACTTAAACGTGCCAGTGACTTGCGGCCGCTTCCACCAACACCGACAAGA
AGCGCATGACCGGATGGGTTTGAAATAATGCGTACGATGCGGGTAATATGCTCGAGTGCGTCCTTGAACAAAACCAGGTCCATTTTCGCGTTTAACTCAT
TGTGTTCTGCCAGCGCTTCCTCGACGGTAGCATGAAGAACTTGGAACGATACCACCTGATCGTATTCATTAGTACGCAAGCCATTTGCAAAATGACAAAA
GAGAACTGGGTCTGTTTGAAGTAGTGCCGAATCGCTGCTGCTCTCTGTGCTAGAAGAAACCGGGGCAAAGTAACGCATAAAGTTGAGAGCGGGAAAGCAT
TTTCTAGCTTGCTGTTGCACAATCGATGTGAATTTGGTTTGATCCTGGGTGGAAACCATGCGGTCTCCGTAGACCCGTGCAGATTCATACCCACAACAAC
GCGAATTTGAGCGGGTCCTCAAATGTTGGTGGTTTTGCCATCAACAGTCCTTGGAACACGTTCGCTACATGTCGAATATTGAATTCGTAGTGAAAATTGG
CAGCAGTCTTACGAAAGGTACTGCACACTTGCACGTGCAGATTAAGCGCAGCTTTTAGAATTGGTTGGCACATCTTGCGGATATCTTCAACGAAATCGGC
AACATAACCCTCTAGAAAAGTTGTATAGATAACCTGTAAACTGGCAGCGCTCAACTGAGGCAGGGCAAAAGTAACAAAATGCCGCTGTAGACGCGGGTTG
ATGCTGAAGCTCCCGGCGTTGGGGTTCATGCAACTCAGGAACTGCACATCCACGATCTGTTTTAGTGAAAACTTAGCTCGATCATACCAGTGTCCATAGT
CCAGATACTGACGAAGCAATGCGATGGCACTCTGCGTACCATACTGATCCACCTGAGGAAGATTTAAATCATCTAGGAAGTATATCAACTGGTCGCCGAC
GGTTGGACCAAAAGTAGAGCCAACTCGTTTTGAAAGCTTCGATTCGAGTATTGCTTGTAATGCGAGCGCATTTGTGTAGTAGTTGAAGTTGATACTCATA
CTGGCTGCTGGGCCTTTAGTAGCGACAATTGACGACGCTGTTGGAGCGGAGGATGAAGAAACAGCACTAGTTTTACCTCCTGAGACCCGACCATCTAGAT
TGCTGAGTAACCCCTGCACCAGCTGTGTCTTTCCTGTGCCCGCATTGCCACAGAGCATGAAAGGACGCTGCTCATGAACCATGATACTCATCCAACTTGT
AATAGAAGCCGTCTCAGGAGTAGATACCGTGACAGATGACATGGCAACAGATCCATCGAAGTGGACTGCTTTAAAGTACGGCGACGCCCTCCATGTGTCG
AACGTTAGCGTGTTGGGGTCAAGCCAGTAATCAAACACAGTGTCACGAGCAGGGAACTTGATGGTCTTGAACTCACTTCGCCACCATTCACTAAACAGCT
TGCGATAATCTGTTCCATCGTCCGTAATTGTGAGTGCGGCACCAAACGCCCAAACTGATATAAAACCACTCAGGATATCCACTTTCTTGGAATCTCGTAG
GGTTTCTGCGTCCAGCACTGCATCAAGAAAGTACAAGTAGGTTTGCACCATAGTTATTTCCTGCATTGGTACAATAGTCTTGCAACATTGCTTAACAAAC
GAGATGATCGGATCGATGTACTTATTCATAGCCTCCCCCAAAGCTGCGCGTTGCTGTACAGAGGTGCCCTTAGTTGCCACCCAGCTAGCCAAGAACGATC
TCCATTGAAAACCATCGTCATCAGATATATAAAGAATTCCCGCACGAGATACTGTCGCAGGGGTTGCATACTTCAGATCCCGGATTTCAAATAAGAGTCG
CATGTTCGGCTTCAGCGGGATGCGCTCATTCGAAGCAAGCGTGAGCATTTTATTGTCATCCATGACAGAGTTCATCGACTCAATCCAGTTAGCGTCCAGG
TCTCCATCCAGTACAATCCATTTCGGGCGAGGGTCTGCGACCGAACTACTAGCCACGTCGCGCATGATCTTAGACAATAGACCATCTTTCCATTCTCGTG
TACCAAGCACCATATATCCATAAAGATCTTCAGTAGAAACTGACTTGGGGTTGAGGTCAATGACTTTCGTCGTGTACTGCTCGCCTTTCTTCTTCCGAGC
AGCAATAAGCGTCTCACAGCACTCCGTTTTACCACTTCCCGGTGGCCCCATCACAAAGACACAGTGACGAATTGCTAGCAGCTCTTCCAGCTGAATAACT
TTCAGCCGGAACTGTTCATGCGGCCAAAGCCCGCGATCCTCGCACGCAACGTGAACGTACTTCTCCATCACCTCGTCGATCTTCCGCGGTAGGTTCAGGT
TGGGGAAGAGATCACCAAGTAGCCCCGTGAATATAAGTAGGTCCTGTTTCACGATTTTGGGCAAGTTAAAATCTCGAAGGGAGCGCATCAGAATTTCTTG
CTCGGAAAATTTCGGCTCAGCACGCTTAAAGGTACCAGCAACGACGAGTACACTTTTGACAGCTCGAAGGCCCCAGTCATAGTGGTCTTGTTTAGAGAGA
AGCTCTCGAAGCAAGGAATATAGACTAAAGAATTTCGTAGCAAGAAGCTTCGCCTCTCGGAATCCTTCTGCCATTAGCATGTTCTCGCAGATCAACACGA
GATCGGGCGCCATCACTGTAATGGGTCGGAATAATGCTTTCAAGCCTTCAGGCAGTTCAGAACGACCGAGATAGCCAGGATTCATGGTAATGAATGTCCC
GCATGTGGGATCAAGCGTGACCGAGTCTCCTTCAACCACAACATGACTGCTTTCGCCTCTAATTCCATCGCAGACAGCTTTGAATTGGACCGAGCACACA
GATAACACTTCAGGAGCGAGACGGTTGAATTCATCAAAGCACCCCCACGCGCCTGCACTCGCTAAGCCTTTGAAAATGTTCCCCAGATTTTTGTAGTCCA
TTTCAGGGGAGCAGTTAAACACATAACATACTTTGCCTACCATATTTGCAAGATCTTTCGTGGTTTCTGTTTTTCCTGTTCCGGCAGGCCCTGCTGGAGC
ACAACCCATTTGAATGTGAAGAGCCTGGGTGGCAGTAACATAAATTCTGTCAGTCAAGGGCGTGATCACGAGCCTCGGGCCATTGCCCAAATACTCGAAT
CCGTAGTCGAATGTTGCGTCACAGATTTCCAGATATGTGTGATTCTGATGATCTGACCGTCGTGGCTTTAACTGCGACTGCCAAAGGAACGAGCTAGGTA
TCGTGATCTCTTCATACAACAGCTTCTGCACAATATCTCGTGAATGCGCATCCATAGTGATCATGCACATTGTACGTTGGCGATCCCCTTTCGGCAGGTT
CGTTTGAGTCAGCTTAATTAAATCGCTGAGCTGAATCATCACTTTCTCGAGAAGCTCCTTCATGGCGGTCGCATGACCCTTTGAAATGAGCTCAAACGCA
TTTTCAACGCTTCTTACGTATTCAATGCCAGCGACAAGCAGTGCAATCTGAGCGGCATCCATATTATCTTTCGATGCGCACCCTCACTAACTGGTGCAAC
TTTCTGCAGCAACCAGTCGACTCGATTTTGCTTAGGAAACCGGTTGATTGAGAGCGTAACATGACCCTTTAAGGTGAGCTGTATGGATTCCAGTATCGTT
TGCATATAAAGTTCAACCTTACCTTCCAACGGTACCATGTTCTCGAATGAAATGGTCTCTTTCGCAGAATCGTTGGATGTAAAGTGAGTGGCAAGCATTG
AACTAGCCGCTCCATTATTGTCTTTCTGTAGGAGCAGCGTATGTGTAGCCAAGAACACCTTCTCGAGGTGAATCATGATCTTCTGCGGACTGCTTCCGTT
CGAAAGTATGTCGAGCAAGTCCGCTTCTGAAATGAAATAGAAGCGCGGGAACAAGCGGCGCTTGGAGTCGAGATACTCCTTTAGCGCTTGTTGGCACTTT
TCCAATCGTGAGCGAAGATCATTTAGCAGTTCGAGCAAGCTAGGAAGCTGGCAGGCAAGCAGTACATTCCCAGGTGGTTCCTGAGCCCACATCTGTTGCA
GTGTTTGGCGGACCAACTCGTCCACATCTTCAAACCTCGCCGCCTCGTCAGGCAACTCCCGTTTAACCTCCTCTGACTGCATAAAGAGCGGTTCCAGATA
TGACCATGATCGCTGAATATCTAATAGGGCTCCAACTGTTTCAGAAACAAGCATGAGCTTTGATCGCCATAGCTGTGTCTGCTCCTGAAAAAAACTATTT
CGCCCAGAAGCCATTCCTTGTATTAGCAACTGGTCCGACTCAAGCATCTCTACATCGTCTTCCGCCATGTGTAGTAGGGGAACTGTCGTTTCCTTATACG
GAGTCATCGTCAGGCAAATGTTAGACCAACGATTTTCAAGCTCGTACAGAGTTGATTCTTGTTTGGCTTCTTTTTGAGCTCGATCTGTAATTTCTTCAAC
ATCCCGCTGGAACTCGTGGAGATTTAGTGCTAAAATATCTGCAAATTTAATGGATGGGTTATCGTCCGGGCAATCGAACGTCTTTCCTGAAACTGCAATC
AGATCTTGCCAGTGACGCCTTCGCATTGATGGATGCCGCAGAGCTTGAAATAATGGACACGTACTAAGAAAGTCCTTTACTAGTCGCTCAAACTTTTTAA
ATGCGTCGCAATCGCGAATGTCTTTGTGTGTAGCTTTTACCAGTGATAGGAAAGTTTTCGCCTCTTCTTCCAAAATAATACCATCAATCATGCTCCACGG
AATATCTCTTGACAAATCAATTTTCCTTGTTACCTCTGAAATGGCTTCCCACAATTGATTGCAGTGGGTAAATGTCCTCTGGATAGACGCTAATACGGAG
GCACAAGGGTCCATCAGATCTTCGCACTCCAGAATCTCTGCAATATGCTTCTTTTGTTGAAAAAAATCTCCATCTTTTTCCGCATTTGCCTGCTCGCCAG
AAAGTAGTGTTAACGCCGCGTTGACACCAACAGAAAAGTTCCAGAATGCCTTCGTTTTAAGCTGGGTCTCCTTTGCTCGCAGTTCTTCCATATAGACGGC
AACCTCGTCACGAAACTTTAAGCTTTGCGTAGCAATCAATGGTGCGATACGATTACTTGCCGCGGGCACCTTCTTCAGTACCTCCCCCCAAGCGACTTCA
ATAGCCAACAGAATGTCGAGCTCCTTGGTGACAATGATACCAGCATCTTTAAGGAAGGCGATTTCCGCACGGAGTTCCTCAATTGATAAAGATATCGCTT
CTCCGCGTTTCTCAACCATAAATACGTGTTCTTTCAGTCTGATTAACGCAGCTGTGACCTGCTCAGGAGTCCAGGTTGGGTCCGACAAAGGCTGCTCCAG
CCCAATGTTGCACTCTCGTGTCGACTGCTGAAGCCCCTGTAAGTCATGCAAGACTTGGTCTATCACGAGCTTTCCCGTCATTAAATTCATCTCTCGGGTA
ACAATATCATCGAAAGTTGCCGTGTATGGTGACCCGCGAATAGGCCCTGCGTTTCCACCAAATGTGCCCTGGAACTCAATTCTTACCTGGTACTCACCAG
GGCTCGGCACTGTGTAACTTACAAGGTACTTGCCGTTTAGAAGATCCTGAATCTGCAAACTCGGCAGGAAGATGGGATTGGAGTCGTCGAGCGAGACTTC
GACATTAAACTCGTCCCCACCACGTGTCCGCAGATCGCGCCGAGCGTCTCTCGCCTGGATAATAAAGCACGTAGGCTCGCCACTAGCTCCACCCGATAAC
ACACCGGGGCCATACGCGAAACAAAGGGGTGCATCGGTAACCGAAAAGTAGCTGTATGTTTGAAAAGTTGTCGTGAACGAGTCACCCTGAAGTGCTACAC
GGATCTGAATATCTCCAGCAGGGTACGCAGTGAAGTCCGGCGTCACAACATTCAGTGTGTGATCATTGACATATTCTCCAGGGACATCCACCGATCCTTT
TCGACACGAGAATCGGATAGTCACTGCTTTATTGACAAAGTCGATGCCTTCGATCACCAAGGGAGTACCACCCGTAATCGGCCCAAAATCTGGATAAACC
CCAGTGATACCATAGGGAGGTCCGACAACGCAGCTTACGTCTAGATAGAACATATCGTTCAGCCAAACGTTGGCCCATCCACCGAAAACAATTAATCGAC
TGCCCTTATCATCATATGCTAATGTTGTATCGCTTCGCCCGCAGGGTGGCGTCCCCTCGATCTCTGGAATGGACCAGCTCATTTCACCCGTGTCAAGCAC
ACTCAAATCGTTCATGTAGTTTCCTTGGGCATTGTAGTTGTTTGCTTCACCCACTACGCCGCCAAACACGAAAACCTTTGCGTGTGGTATGGCGAGTACC
GCACAACACGCGTGGTTCCACCTTGGCAGCGTCGAGGCCATATGCGTGCCTTCCACAAGTGTCCACGAGTTCACGGCCGAGTCAAAAATGTGCAAGTCAT
TAAACTGTGCGACACTGTTCCACCCTCCACACACCAACATTAGGTCGTCCACAGCACAGGCCTGATGGCCTGCTCGTTTCTCCGGCGGTTTGCCCTTGCA
TGTGACTTTGGTCCAACTCAAATCATCTGTCCGTAGCATATACAAGTCGTCGAAATCTCTCCTGCTGTATCCTGTGCCTCCATAGCCTCCGAACACGTAA
ATAGAGCGTCGTATAGCAACTGCAGAGTGGGCTCCTCTGGGAGCCGGCAGTGTCGGCGCCACAGTCTTGGCCACACTGGCACGATGCAGAGCATTGTTGT
TATTACTATTAACGGCGGTCCCCGGGGCTCCAGCTTGACTCCAGTCCAGCGTGATGGGGTTGAAGATCCACAGGTCGTTGAACCGCGCGGAGCTGCTGTG
GAACCCGCCGAACACGTAAATCTTGTTGTCCACGACTGTGGCCGAGTGTTTCCATCTGGGCGGGGGCCACGCGCCGCCCAGAGGCGAGCGCAGACGCTCC
CATTCGCTCGGAGCGTTGGCGTTTATCTTAAGTGCGAACAGGTCGTTCGTCGGCCCTGGAGGCTCGGAGTAGTCGCAGCCGCCGAACAGGTAGCCGCTGG
AGCCCACGATGGACAGCGAGTGACCCGAACGCCTGGTCGGCGTCTCTCCGTTGCGCCTCG