Description :
From Genome Similarity Track
Location :
contig_61:28675- 41335
Transcript NameFunction/comments
g10841.t1XP_002908453.1 homogentisate 1,2-dioxygenase [Phytophthora infestans T30-4
g10842.t1hypothetical protein

Sequence
12660 bases(100 bases per row)
GATCGGATCTAGGAATCTCTTTGCATGACAAGCGCCACACCAGCCAATATCCACTTCGCCTTGGGATGGATCGTGTTCAGTGTAGCAAGGAACACGTACG
TCGGTCCTCGAAGTGTTGTCTGATATACAGGACAATCAAACACGTCCTTGCTACGTCGGAAGTGCCCCACTGCCGTGGCCTCCCATTTGCTGTCAATCAC
CACAGCTCGCGCATAGATTACAGGTGCAGCTGGAAGCAATTCCTTTGGCATCGGATCCACTAGATGCCCGCCACAAGGAATAGAGTCGACCTCGTATATA
AACGGCGAGGTTTTGTCGCCGTCTTTCATGGGATATTCCCACCGCGCGCCCTCCATGAACAGACCATGAATGTACGCACCCATTTCAGGATAAGATTCGG
CCCCCTCAGCATCGGCAATGGGTGTAACATGAGTCTCAATCGCCATGGAGTCCAGTGGGATTCCGTGTGTTCGCGCCGTGCACTGCTTGATTGCAGTGAG
GAAAGCTGTTGGATTGAACAAGCCCGAGATCCACATCGAGTAAGGAAGGCGGAACTCGTTTGTCCAGCTTGAAAGAAACTGGACACGCTCCAGTAGATCG
GCAAACCACAACGATAGCGACTTCGCGACCACCACGCGTATCTCTCCCAGGAGCACATGTGCAACACATTACGACCAGGGACTTGGTTGATTGAAAGCGC
CTCCATGAGGTCCTCCATCTGCTCTGTCATGTTCAGCGTGCCCTGAATTCCTTTCGTGAGCTCGACGAGACTGGTTTGAATCTCGTGGAGTAGTGTGTGC
ATGCGAGTAGCTTCTTGCAAAGCGACTACAACGTAAGGAGATTGATCGGTTGTCAGCAATGGATCTGCCTTGGCTTGCAAGTCTGCAAGATCAATCTCTG
GTGGAAGCTTCTCAAGCAACTCTTCGATAACGGCATAGACGTGAGCATTTTCTTTTGCCAACTCAGATGCTGCACTCCGTGCAGTCTTAGTCGCTGTGCC
ATCAGCAGACGTGGATGGTCCTCCTGATGGCTGGAATTTTGCAATTGCCGCGAATAGTTCATTGGAGGCGTCCACGAGGTATCCTACCTCCGCGTTCGGA
TGCAATCCGTACACCGTTGGGGATTCACTCGGCAGCTGTGTTTCGATATGGTCGACGTACTTGGTATAACTAAAAGTAAACGGGTCGGGACACTTAAACC
CAGCAGTGAGTTCTTTGCCGTGGAAAATGTCTTTTGTAAAGACTTCGTTCAGGTAGGTGTTGTTCGTAATCCGGTCCCAGTGATCCGTGATATGGCCACC
ATACATAATTTCTCCAAAGATGTAGCGCAGATCGTCCCATGGCAAGCTCTTCGATCTACTCGTTGCCGCAGTATCAAGGTACCGTCGAAGTACATCCGAG
CAGATAAGTAAGTCCCCCGTGTTGAAGCTGTACGGCCGACTCCAACCTTGGCAGCCAAACCTCCGCCGTCCTAACACCAGCGCATGGAAGAAGCATAAGG
CGAAGATACATCCTTGGTATTCGCTGGGCTGAGCACAAGCGTCAAGCTGCTTCAGCGAAAAGTTAGCCCAGGCTCGACGCAAATTACTCTTCAAGTCAGT
CGGCGCCTCATTTGCAACCTTGATGCAGCTTTGTAGAAGCGACTCTGGAAGATTACTGAGTGAGGCCAAAGCTGGGCCCTCGGATGAGAGAAAACACCGG
AAATTCTGATCTGCAGATACAGAGTAAACTTCCAAAGTTCTCTCTAACCTCGGGAGCCATGACTGCATCAAATGGATGTTCTGAAGAATCACCCAATTTC
CTTCTCGAGAGAACTTCATGAGCACACTGTCAGCGTATTCCTCCTGGCCTTGACCCATAGAAATGTTGATAAGATTTCCCCGCTCGTATGTGAAATCAAA
CTTTTTGCCAAGCGTCTCCACCCACGAGGTTGGGTCCACGCCAGGAAATAGCACGAAAAACATCGGCGTTGAGGCACTCGTTTCTTGGTAAGTCGCCTCC
ATGTCAAAGGGTGGCTGCTGAACCATCTGCTTACCAAACGTATCACTTAGATACGAGCGCAGAGCAAAGATCATTCGATCTGGCCGGAGCACGCGTACGA
TGTGCAGCAACTGGACTGGCGTGACCGAGGTTTTGTATTGTCCGGGGAGAGGTTTCACTTCGGGCTTTTCAGCATCACACCATTCTCGCCATTCCTCACT
ATCGGAGCGCATAAACGTTGTGAGCTTCTGGAGGCTGTGTATATTTCCTCGAGTTTCCGAACGCGAAGCCACATTGTTTCAGACAACCACTCGCTAAGAA
GTCCCATCCCTGACCCCATGTCACTTGCAGTACTGCAGGTCACTAACTGATGAACGTCGATCGCATCGATTTTCTTTTCCGACTGCAAAATCGAAAAACA
CAGTTGAGTGGCCAAAGTCAACTTGTCCTTCTCAAAGAGCCCCCGACGTATATAGTTGAATACCACGTCAGTAATGGATGCATTAAGCTGCGTACACCGG
GCCTCGATTTGTGCTGTTGAAGGCTTTTCTTCCTGGTCCGTTTCCTTCATGAGGACGTCTAAATCTTGTTCGGTGTTAGTGTCCATCACCCGATCCGCCA
GGAGCAAATCCGAATTCCACTGAAAGCGTTGCGATACAATAACCTTTTTTGCCGCTGCCTTCAACCGACTAAGCAAACCTCCGCCACCCGATGAAGGCGG
TCTTCCAGGATCCTTCTCGGGTTGAACCAAGTCAATTCCACGCTGAAAAATGACGACGTACGCGTTCAAAGAGTACACATAGTATGAGTGCATACGATGC
AAACCATCCATGATGAAAAAGAGCAGTGCCCCCCGACTTGCCACAGATTGATACTTCGCGCTCAGCTCATTAATTTGAGCTTCGTACTCGGTGGCTTTGG
CGGCTTTCTTTGCGATTTCTTGTGAAGTAGCCTTTGTCGTTTCCAAGTCCGTGATTACCTGCACATTCTCCGTCACATCCCCCTCGGCATCGGCAAGACT
CGAAAGAATACGATCTTCCAGCGTTTGTATCCGGATTTTAAACTCGTTCTGTTGGTGAATGAGAGCTGTACGAACTTTAGCCATTTTAGGCCACTCCTTG
CGCACTACGAGAGCCAAAAGCTGGTCTTCAAGGCCTTGTTGCGTAACAGCAAAATTGATCATCGTAGTCTCGGCTTGCAGCTCAGGTGGGTAGTGAGGAT
TCGACAGCTTTGTATGCAAATACAGTCGGAATTCAGGATGTAGTTCGACAAGTTTATCACCCATTTTCAGTAGGGTTTTGCGGCCTCGTACGGTGGTAGA
CCGAGAGATCACGGGCCACATACACACCTCCAGTTTCTCTCCCATATTTTCAACTATCACTGTGTAACCGTGCTCGACTGCAGTCTCCAGCAGTTGAGTC
AAGTTTGGTTGATCTTGACGTACTCTGCAGGGAGCTAGGTGCCGCCCGTCGTGCATGCTTCTCCATTTCACGAAGCCAATAAATACCTTGCAGTTGTGGG
TCGATTAGTAGTGGTGAACGAGTACTGTTGCGCACTATGGCACCATTTTCGACCGAAACGCGATCGCTTGGAAGCCCTTTCGTATTCCATTCTGCAATCT
CTGAAGGCGTTGCAAGAATTTGTAAAGGATTACCATCTTCTGACATTGTGCTTATTGCAGGTGCAGCCTTATCCTTATCTTTGTCAGCTTTAGGTGGCTT
TTCAGTCAGCGCTTTACGAAGGAAAGGCAGCCACTTGTCGTTGATAAGCAAATCTCGAAATGGCTTTGTGAAAGCGCCAACATACGAAACAAAGCTAGCA
GCTATCACAACGTCACAGACCAACATTTCGGCACTTACGCGAAGCTGCTCAAGTTCATGCGCCCAGCGTTCACTCTCACTTCCGAGAGCCTTTGCTAATC
GACGAGCAAGTTCCATACGAAGGCGACCCCTCTCCAGCAATCCCACTGCGTCCTGGACCTCCTTATTTGTCTTGTCAAATTCTTCTGTCAATATGGCAAG
CTTCTCCTCCAGCGCCGCTACCTTTTGATTCACCAACTCCAGCCTCTCGTTCGCGACCCGTAGTTTTTCGTTAGCCTCTTCTAATGCTCGCTTTTTGGGC
TCAACCACCACAATGGCATCGTAATAAGCCACGATATTGATTACCCAGGCACACAACCCAGCAGAGGCAGAGTTTTTCTTCTCAATTGCCTCCACATTGA
AGTGTTCAAGCAGTAAAAACGGACGGATTTCCTTCCAGTTGACCTCAGGTATTTGCTGGTTATCCACCAGCGTCTTGAATCCTTTAAGTTCGTCGACTAA
CGAGTTAATGTTTCCCAGAAGCGCTTTCTTCGTGGCCTCCCATGATCGATCCTTGTCTTTCACCTTGCCATTTTTCTGGATGATCACATTTGGATTCACG
CCAGCAAAGAGCACGACTACAGCGCCGAAAACGTCGCCTACACCTGCAGGAGGCTTCGCCATTGTCTTGCAGTTTCCCAGATCCTTTTTATTTAGCGTGT
CTAAAGCCGCCATCGCAGCCTCCACCATAGGCTCGGCTTGAGCAAGATCCGCCTCGGTGTCCGCCTTCTTTGCAGATACATCAGTCTGGATAATAGCGCA
CTTCTCGCGCTCAACGTTTGCTTTTGCTGTCTCGTTTTCAACAAGCTCCTTGTCTTTTTGAAGACGTGCTGCTAACTCTTCAACAATAACCTTCTTGTTC
TCTGCTTCTTCTAGCGTACGTTTCAACTCTTCCTCCATGGTTGCAACGATTTCTCCTGTTGATTCCATCTTCTCAAGTCCGCTTTGAAGGCGTTGCATCG
CGTTTTGGTGTCTGGAGTGCTTCTGGGCTAGTAGCCGACGATACAGTGTCAAACATTCCAGATATGACTTCGGAGTCGAGTATACGCGACGCTTTTCACG
TGCGAAAAACTCACTTGCTAATGTGTTTGTACTCTGAAAAGCGAATGGCATGAAATTTTGCACCGCCATCGCCACATTTTCTGCGGGACTCAACTGTGGA
ATGTTATCAAAGGAAAGGAAGCGCGCAGCAACAGACCGCAGCGCTTCCTTAGGCCATGGCTGAAACCAGTCGATCAACGCACAGTTCACTAGGGCAGGGA
ACTTTCGAGCTTGCATTCGGAAGTCTGCCGTTGCCGGAGAGAAACAGAGGACAACATGTAGGTTGCGCTTAATTTCCTGGACAAGCCATCGCCATGCACG
CTCTTTTTCAGACCCTTCGGTTCCAAGATTGATAGCTTCATTACCATCGCCAGACGAATCTGCCGCGGCACTTGCTGCTAGCGCTGCCACCATCTTCGGC
TGGAATTGCTGAATCAAATTGGTCTGCTCGTCAACATTGTAAAGATCTGGTATATTACCACTCGACAGCAAGTCGTTCAGATACACGAGCATTCGCTCAT
TCTTAATTTGATTGTCGTCAAACAGGAAAACTAATCCGTCACCTTTGACACCTGCTTTCATGAACATGTTCTGAAGATCGGATTTGAAGTCCAACAGTGA
ATACGCTTGCGTAATTGTGATCTCCACCAGAGCGTATCCACAGATGAATGTACTTAAACGTGCCAGTGACTTGCGGCCGCTTCCACCAACACCGACAAGA
AGCGCATGACCGGATGGGTTTGAAATAATGCGTACGATGCGGGTAATATGCTCGAGTGCGTCCTTGAACAAAACCAGGCCCATTTTCGCGTTTAACTCAT
TGTGTTCTGCCAGCGCTTCCTCGACGGTAGCATGAAGAACTTGGAACGATACCACCTGATCGTATTCATTAGTACGCAAGCCATTTGCAAAATGACAAAA
GAGAACTGGGTCTGTTTGAAGTAGTGCCGAATCGCTGCTGCTCTCTGTGCTAGAAGAAACCGGGGCAAAGTAACGCATAAAGTTGAGAGCGGGAAAGCAT
TTTCTAGCTTGCTGTTGCACAATCGATGTGAATTTGGTTTGATCCTGTGTGGAAACCATGCGGTCTCCGTAGACCCGTGCAGATTCATACCCACAACAAC
GCGAATTTGAGCGGGTCCTCAAATGTTGGTGGTTTTGCCATCAACAGTCCTTGGAACACGTTCGCTACATGTCGAATATTGAATTCGTAGTGAAAATTGG
CAGCAGTCTTACGAAAGGTACTGCACACTTGCACGTGCAGATTAAGCGCAGCTTTTAGAATTGGTTGGCACATCTTGCGGATATCTTCAACGAAATCGGC
AACATAACCCTCTAGAAAAGTTGTATAGATAACCTGTAAACTGGCAGCGCTCAACTGAGGCAGGGCAAAAGTAACAAAATGCCGCTGTAGACGCGGGTTG
ATGCTGAAGCTCCCGGCGTTGGGGTTCATGCAACTCAGGAACTGCACATCCACGATCTGTTTTAGTGAAAACTTAGCTCGATCATACCAGTGTCCATAGT
CCAGATACTGACGAAGCAATGCGATGGCACTCTGCGTACCATACTGATCCACCTGAGGAAGATTTAAATCATCTAGGAAGTATATCAACTGGTCGCCGAC
GGTTGGACCAAAAGTAGAGCCAACTCGTTTTGAAAGCTTCGATTCGAGTATTGCTTGTAATGCGAGCGCATTTGTGTAGTAGTTGAAGTTGATACTCATA
CTGGCTGCTGGGCCTTTAGTAGCGACAATTGACGACGCTGTTGGAGCGGAGGATGAAGAAACAGCACTAGTTTTACCTCCTGAGACCCGACCATCTAGAT
TGCTGAGTAACCCCTGCACCAGCTGTGTCTTTCCTGTGCCCGCATTGCCACAGAGCATGAAAGGACGCTGCTCATGAACCATGATACTCATCCAACTTGT
AATAGAAGCCGTCTCAGGAGTAGATACCGTGACAGATGACATAGCAACAGATCCATCGAAGTGGACTGCTTTAAAGTACGGCGACGCCCTCCATGTGTCG
AACGTTAGCGTGTTGGGGTCAAGCCAGTAATCAAACACAGTGTCACGAGCAGGGAACTTGATGGTCTTGAACTCACTTCGCCACCATTCGCTAAACAGCT
TGCGATAATCTGTTCCATCGTCCGTAATTGTGAGTGCGGCACCAAACGCCCAAACTGATATAAAACCACTCAGGATATCCACTTTCTTGGAATCTCGTAG
GGTTTCTGCGTCCAGCACTGCATCAAGAAAGTACAAGTAGGTTTGCACCATAGTTATTTCCTGCATTGGTACAATAGTCTTGCAACATTGCTTAACAAAC
GAGATGATCGGATCGATGTACTTATTCATAGCCTCCCCCAAAGCTGCGCGTTGCTGTACAGAGGTGCCCTTAGTTGCCACCCAGCTAGCCAAGAACGATC
TCCATTGAAAACCATCGTCATCAGATATATAAAGAATTCCCGCACGAGATACTGTCGCAGGGGTTGCATACTTCAGATCCCGGATTTCAAATAAGAGTCG
CATGTTCGGCTTCAGCGGGATGCGCTCATTCGAAGCAAGCGTGAGCATTTTATTGTCATCCATGACAGAGTTCATCGACTCAATCCAGTTAGCGTCCAGG
TCTCCATCCAGTACAATCCATTTCGGGCGAGGGTCTGCGACCGAACTACTAGCCACGTCGCGCATGATCTTAGACAATAGACCATCTTTCCATTCTCGTG
TACCAAGCACCATATATCCATAAAGATCTTCAGTAGAAACTGACTTGGGGTTGAGGTCAATGACTTTCGTCGTGTACTGCTCGCCTTTCTTCTTCCGAGC
AGCAATAAGCGTCTCACAGCACTCCGTTTTACCACTTCCCGGTGGCCCCATCACAAAGACACAGTGACGAATTGCTAGCAGCTCTTCCAGCTGAATAACT
TTCAGCCGGAACTGTTCATGCGGCCAAAGCCCGCGATCCTCGCACGCAACGTGAACGTACTTCTCCATCACCTCGTCGATCTTCCGCGGTAGGTTCAGGT
TGGGGAAGAGATCACCAAGTAGCCCCGTGAATATAAGTAGGTCCTGTTTCACGATTTTGGGCAAGTTAAAATCTCGAAGGGAGCGCATCAGAATTTCTTG
CTCGGAAAATTTCGGCTCAGCACGCTTAAAGGTACCAGCAACGACGAGTACACTTTTGACAGCTCGAAGGCCCCAGTCATAGTGGTCTTGTTTAGAGAGA
AGCTCTCGAAGCAAGGAATATAGACTAAAGAATTTCGTAGCAAGAAGCTTCGCCTCTCGGAATCCTTCTGCCATTAGCATGTTCTCGCAGATCAACACGA
GATCGGGCGCCATCACTGTAATGGGTCGGAATAATGCTTTCAAGCCTTCAGGCAGTTCAGAACGACCGAGATAGCCAGGATTCATGGTAATGAATGTCCC
GCATGTGGGATCAAGCGTGACCGAGTCTCCTTCAACCACAACATGACTGCTTTCGCCTCTAATTCCATCGCAGACAGCTTTGAATTGGACCGAGCACACA
GATAACACTTCAGGAGCGAGACGGTTGAATTCATCAAAGCACCCCCACGCGCCTGCACTCGCTAAGCCTTTGAAAATGTTCCCCAGATTTTTGTAGTCCA
TTTCAGGGGAGCAGTTAAACACATAACATACTTTGCCTACCATATTTGCAAGATCTTTCGTGGTTTCTGTTTTTCCTGTTCCGGCAGGCCCTGCTGGAGC
ACAACCCATTTGAATGTGAAGAGCCTGGGTGGCAGTAACATAAATTCTGTCAGTCAAGGGCGTGATCACGAGCCTCGGGCCATTGCCCAAATACTCGAAT
CCGTAGTCGAATGTTGCGTCACAGATTTCCAGATATGTGTGATTCTGATGATCTGACCGTCGTGGCTTTAACTGCGACTGCCAAAGGAACGAGCTAGGTA
TCGTGATCTCTTCATACAACAGCTTCTGCACAATATCTCGTGAATGCGCATCCATAGTGATCATGCACATTGTACGTTGGCGATCCCCTTTCGGCAGGTT
CGTTTGAGTCAGCTTAATCAAATCGCTGAGCTGAATCATAACTTTCTCGAGAAGCTCCTTCATGGCGGTCGCATGACCCTTTGAAATAAGCTCAAACGCA
TTTTCAACGCTTCTTACGTATTCAATGCCAGCGACAAGCAGTGCAATCTGAGCGGCATCCATATTATCTTTCGATGCGCACCCTCACTAACTGGTGCAAC
TTTCTGCAGCAACCAGTCGACTCGATTTTGCTTAGGAAACCGGTTGATTGAGAGCGTAACATGACCCTTTAAGGTGAGCTGTATGGATTCCAGTATCGTT
TGCATATAAAGTTCAACCTTACCTTCCAACGGTACCATGTTCTCGAATGAAATGGTCTCTTTCGCAGAATCGTTGGATATAAAGTGAGTGGCAAGCATTG
AACTAGCCGCTCCATTATTGTCTTTCTGTAGGAGCAGCGTATGTGTAGCCAAGAACACCTTCTCGAGGTGAATCATGATCTTCTGCGGACTGCTTCCGTT
CGAAAGTATGTCGAGCAAGTCCGCTTCTGAAATGAAATAGAAGCGCGGGAACAAGCGGCGCTTGGAGTCGAGATACTCCTTTAGCGCTTGTTGGCACTTT
TCCAATCGTGAGCGAAGATCATTTAGCAGTTCGAGCAAGCTAGGAAGCTGGCAGGCAAGCAGTACATTCCCAGGTGGTTCCTGAGCCCACATCTGTTGCA
GTGTTTGGCGGACCAACTCGTCCACATCTTCAAACCTCGCCGCCTCGTCAGGCAACTCCCGTTTAACCTCCTCTGACTGCATAAAGAGCGGTTCCAGATA
TGACCATGATCGCTGAATATCTAATAGGGCTCCAACTGTTTCAGAAACAAGCATGAGCTTTGATCGCCATAGCTGTGTCTGCTCCTGAAAAAAACTATTT
CGCCCAGAAGCCATTCCTTGTATTAGCAACTGGTCCGACTCAAGCATCTCTACATCGTCTTCCGCCATGTGTAGTAGGGGAACTGTCGTTTCCTTATACG
GAGTCATCGTCAGGCAAATGTTAGACCAACGATTTTCAAGCTCGTACAGAGTTGATTCTTGTTTGGCTTCTTTTTGAGCTCGATCTGTAATTTCTTCAAC
ATCCCGCTGGAACTCGTGGAGATTTAGTGCTAAAATATCTGCAAATTTAATGGATGGGTTATCGTCCGGGCAATCGAACGTCTTTCCTGAAACTGCAATC
AGATCTTGCCAGTGACGCCTTCGCATTGATGGATGCCGCAGAGCTTGAAATAATGGACACGTACTAAGAAAGTCCTTTACTAGTCGCTCAAACTTTTTAA
ATGCGTCGCAATCGCGAATGTCTTTGTGTGTAGCTTTTACCAGTGATAGGAAAGTTTTCGCCTCTTCTTCCAAAATAATACCATCAATCATGCTCCACGG
AATATCTCTTGACAAATCAATTTTCCTTGTTACCTCTGAAATGGCTTCCCACAATTGATTGCAGTGGGTAAATGTCCTCTGGATAGACGCTAATACGGAG
GCACAAGGGTCCATCAGATCTTCGCACTCCAGAATCTCTGCAATATGCTTCTTTTGTTGAAAAAAATCTCCATCTTTTTCCGCATTTGCCTGCTCGCCAG
AAAGCAGTGTTAACGCCGCGTTGACACCAACAGAAAAGTTCCAGAATGCCTTCGTTTTAAGCTGGGTCTCCTTTGCTCGCAGTTCTTCCATATAGACGGC
AACCTCGTCACGAAACTTTAAGCTTTGCGTAGCAATCAATGGTGCGATACGATTACTTGCCGCGGGCACCTTCTTCAGTACCTCCCCCCAAGCGACTTCA
ATAGCCAACAGAATGTCGAGCTCCTTGGTGACAATGATACCAGCATCTTTAAGGAAGGCGATTTCCGCACGGAGTTCCTCAATTGATAAAGATATCGCTT
CTCCGCGTTTCTCAACCATAAATACGTGTTCTTTCAGTCTGATTAACGCAGCTGTGACCTGCTCAGGAGTCCAGGTTGGGTCCGACAAAGGCTGCTCCAG
CCCAATGTTGCACTCTCGTGTCGACTGCTGAAGCCCCTGTAAGTCATGCAAGACTTGGTCTATCACGAGCTTTCCCGTCATTAAATTCATCTCTCGGGTA
ACAATATCATCGAAAGTTGCCGTGTATGGTGACCCGCGAATAGGCCCTGCGTTTCCACCAAATGTGCCCTGGAACTCAATTCTTACCTGGTACTCACCAG
GGCTCGGCACTGTGTAACTTACAAGGTACTTGCCGTTTAGAAGATCCTGAATCTGCAAACTCGGCAGGAAGATGGGATTGGAGTCGTCGAGCGAGACTTC
GACATTAAACTCGTCCCCACCACGTGTCCGCAGATCGCGCCGAGCATCTCTCGCCTGGATAATAAAGCACGTAGGCTCGCCACTAGCTCCACCCGATAAC
ACACCGGGGCCATACGCGAAACAAAGGGGTGCATCGGTAACCGAAAAGTAGCTGTATGTTTGAAAAGTTGTCGTGAACGAGTCACCCTGAAGTGCTACAC
GGATCTGAATATCTCCAGCAGGGTACGCAGTGAAGTCCGGCGTCACAACATTCAGTGTGTGATCATTGACATATTCTCCAGGGACATCCACCGATCCTTT
TCGACACGAGAATCGGATAGTCACTGCTTTATTGACAAAGTCGATGCCTTCGATCACCAAGGGAGTACCACCCGTAATCGGCCCAAAATCTGGATAAACC
CCAGTGATACCATAGGGAGGTCCGACAACGCAGCTTACGTCTAGATAGAACATATCGTTCAGCCAAACGTTGGCCCATCCACCGAAAACAATTAATCGAC
TGCCCTTATCATCATATGCTAATGTTGTATCGCTTCGCCCGCAGGGTGGCGTCCCCTCGATCTCTGGAATGGACCAGCTCATTTCACCCGTGTCAAGCAC
ACTCAAATCGTTCATGTAGTTTCCTTGGGCATTGTAGTTGTTTGCTTCACCCACTACGCCGCCAAACACGAAAACCTTTGCGTGTGGTATGGCGAGTACC
GCACAACACGCGTGGTTCCACCTTGGCAGCGTCGAGGCCATATGCGTGCCTTCCACAAGTGTCCACGAGTTCACGGCCGAGTCAAAAATGTGCAAGTCAT
TAAACTGTGCGACACTGTTCCACCCTCCACACACCAACATTAGGTCGTCCACAGCACAGGCCTGATGGCCTGCTCGTTTCTCCGGCGGTTTGCCCTTGCA
TGTGACTTTGGTCCAACTCAAATCATCTGTCCGTAGCATATACAAGTCGTCGAAATCTCTCCTGCTGTATCCTGTGCCTCCATAGCCTCCGAACACGTAA
ATAGAGCGTCGTATAGCAACTGCAGAGTGGGCTCCTCTGGGAGCCGGCAGTGTCGGCGCCACAGTCTTGGCCACACTGGCACGATGCAGAGCATTGTTGT
TATTACTATTAACGGCGGTCCCCGGGGCTCCAGCTTGACTCCAGTCCAGCGTGATGGGGTTGAAGATCCACAGGTCGTTGAACCGCGCGGAGCTGCTGTG
GAACCCGCCGAACACGTAAATCTTGTTGTCCACGACTGTGGCCGAGTGTTTCCATCTGGGCGGGGGCCACGCGCCGCCCAGAGGCGAGCGCAGACGCTCC
CATTCGCTCGGAGCGTTGGCGTTTATCTTAAGTGCGAACAGGTCGTTCGTCGGCCCTGGAGGCTCGGAGTAGTCGCAGCCGCCGAACAGGTAGCCGCTGG
AGCCCACGATGGACAGCGAGTGACCCGAACGCCTGGTCGGCGTCTCTCCGTTGCGCCTCG