Description :
From Genome Similarity Track
Location :
Scaffold_176:28673- 30674
Sequence
2001 bases(100 bases per row)
CGCAGTCAGCGACGTAGCGTTCTCGCTGATATTCGAGACCACTTGCGTGAACTGGGCACGGATCTCGTACCCCGTGAAAAAAGCTATCTGGTAGCTCATC
ACCTCGGTTCCGCCAAAGTCGGCAGGGGGTTTCCACGAAATCGATGCCGATCCGCTTGTCCTATCCACGAGTGTCACGTTTCTTGGTTCACCCGGTAATG
AGATAAACTTCGTCGTCATCACGAGCACGTCGCTGGATTCGCTGCCCCCCTACACGAACAAAACAGAAGGTCGCAGTATATACAAATTAGGCTTTTGACC
GGAAGCGAACTTCGTCAATTGCACACTAACGATATGGCACGTACGACTGCATTGAAGACCTTGTACTTGAGTTTGTACTCGGTGGAATACAAAAGCCGAG
TCATAACGTAGCTGGGGGCGACACCGGAGTAAACTTCGTTAAACACATTTGGGAACTGTGCAGACGTCGCAGATAAGACANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTGGTGTTCAGGCCTCCTAGATCCAGCGACGGTACCAGATCCAAATACAAAGCACCACCTGTCGATTTCGTCACAATAATTCCGGGAGGTT
TGCTTGGCGCGCTTGGGGCTCGCGTGGTGAATGTCACTGGTATTGTTATTGCTCCAAGGATGCCTTCAGTATTCATCGCTCTCACTGTGACAACGTACCC
TGTCAATGACTTTAGCCCGTACAACCCAATGTGCGTCGCGTACGCATCGTAACGCGCGAACTCACGGTTGTTTGCGGTCGTGTTCATGCTAATGCGATAA
AGCAGGATGCTCGCGCCGCCTGAGTCGAATGGCGGCGACCATGTGAAATTGGCACCGCCTCCAGTATACCATGAAATTTGTGCGCCAATTGGCATCGTCG
GTGGCGTTGGTGCTCCCAATCGCATTAAAACAGGTGCCGACAAGTAGCTTTCATAAATTCGATTCGTTGCTGCAATAGAGACCCCAACTGTCGATTTTGC
TGCCAGATTTGTAATCGTCAGTGAGACATTGGAGGTTGTATATGTTTGCGTTGCTAGAACGTCTGAGGTTACGACAACGCGGTATGTGAGGAATGTCACG
TTTGCTGCACCTGTGCTCTCAGGAGCGGTCCACGTCACATTGACACAACCACCAGAAATGGCCGCAATCTTGACGCTTGTTGGCTCCCACGGTGGGGAAA
CGTCGCCGTCATCCAAAATCTGGACGAACACTGGTGTATTCCTCGTACCGAGTCGTGCTCGACCACTTGTGATCGTGAGGTTGAGGCCGAAGAACTTGCG
GATTTGATACTCGTTGTCGTTGACAATTGTAATACGAACTGATACGACGGTCGCCATATCTGCAAACGTCACGACCGATGTCTCAAGCGAGTAGTCAACG
TTTTGAACCGCACCACCAAGAACATCAAATACGTCAACTTGCGCAACCACTGGTCCGCTGAACGCATTGACGCGGACAACTGAGACAATGAGACTGGATA
AAGATTCATGGACAGAATACGATGGCTGCGAAAACTGAAGCGCTCCACTATCGCCATCGTCTTGAATTGTGATGCGAGCTTGACTTGGTGAGCCAATTGC
ACCGGATGCGAAGCTAACCTCAATCAGCTCAACATAGAAAAATCTGTCGGGGTCGTCGATGACAGCGTTATTGATGATGTCAACGGTGATCGTTTGCATT
TTCACACCGACGTCAAAGTATATCGACCCTGTAGCATTTCGATAATGAACTCCAGCACGAGCTGTTCCATCCAGAGTACGAAAATCGCAAGTCGCTGGAA
TGGCACCACCGCGTGTCCGCGTCACATTAACTACCACGCTTGCTTGATCTTCCGAGACACTCACGGCATCGAACAGAAAGCTAATTGTCCCAGGAGACAC
AGGATCTGTTTTTGCGGCGACTGGGTCGCTCCAATCGCCAATNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTCATTCCGCGCGCGCACACTGATAGAGTA
C