Description :
From Genome Similarity Track
Location :
Scaffold_116:28670- 33500
Sequence
4830 bases(100 bases per row)
GGAAGTGGTCACTGCTTCATGACATAGTACTTTCTTACCTGATTTCAGGTCGATCTCGTGACAAAAACATTTTTCCTTAGGTAAATCGCACGGAACTACT
TCTGGAAATACATCATTGGAGCTAATTATCGTGGAAAAGACTTGTCATGAAGCAAATTTCAGGATTGAGACATGTAATGCTCAATCATATTATTCTCGTC
AAGGACACTCTCGGCTATGTATATGCTGCTGAGAACTCGATAGTTCTTGGCAAAGATCATCGCCGACCGGATATCGGTGACGTACTTGCCTTCCGCGACT
AGTACGAAATCTGCTTGACTTTGCCAATATACAGATCGCGCAAGAGCCTTTTGTGTTCAAGCGTTGATACAATGGTTTATTTCCAAAGTTAACTTCGGAG
GCGAAATCAGGTCTTTCATACAAGCGCTTACGTTTGATCCGTCATTGACCAAGTCATTTAATGTCTTGACAATTTGAAGGGGAAATGTTCCCTCTCATTT
CAGAAGTCATATTTTCTTGGTGTTCTCGATACGTATTTGATCACCAGCGATATCCTCTACGTTAGACATTCCAGTCGATCTAGTTCATCGTGTCGCCAGT
GGATAAAAACCGATCCATTGTTCTAGGATGCTGTCCGCTAGGCGAGCCTCCATGACCCGGCCCGACTTCCATTGTTTCTACAGCTGTCGGTAGCGTGCTC
CACAGTATGGTGTTTAGTTACATTGTGATGTTGTGCAGTCGTACTAGCAGCGAACCATCAGTGAGACAATTGCAGTCACTCGTAGTACGTCCACACGCTT
GTGGAAGCACCAAGACGTTTATCAGAAGTCCATTTAATGAATAAGCGACATGCATATAGATTGTTCGACACTGCAAGATGCCTTATGGCTTGTACCTTTT
GACCCAGGGTAACCCAAAAATGACATCGCATTTGTCGTCCAAGTCCAATACGATGAATTTATCGTCATACTGAACCTCTTTTAGCGTACAGCGAAATTCC
GCTACATGCTACATCACTATCTCGCATGCGCCTGTTTCACGGCGTAACGTCATAATCATTTGGCAGGGGTCTTGCGCCATTGAACTTGAGATAGCGATTT
TCTAGCGGTTGGCGTCGTATAAAGTTGTTAGACGCCCCAGAATCAAATTGGGCACGACGTGAAATATCGTTCTTCAAGGTAATGAGGGCAACCTCGGTAC
CTGATGCAGTAAAGCACAATGACTGTGTGCTGGGGGAAGCTCTTGTCAAGAGGCCTGGAGACCCATTTGACGTTGATGGGTCAGTAGGGTGCTTCGCACC
TACTAAACTCGACCTTTTTTTGTTTGTCAATTACGTTGTCGCGATTTGGCAACGGCGTCGAACCCACACCTTGGGCCTTGCTTGGACGAGTGGCGGTTTT
CACGTACCATGGTACGTGGTACTGAATTTGTGCCTTGCATTCATGTGCATAATGCCCTGTATTTAGACATTAATTGAATCTCTTCAATTTCTTGTATTGG
AAACGCGAGAGCTCTCGCTCTCAGCTTGGCGGTGGTTTATTGGATATGGGCTTCCGCTTTCTAACGCCTCAAAGTGCGATTGGAATATTCAGTTCTCATT
GGCTTGTCTTACACTGAAGTTCTCTTGTTCCGAAACCCAAATTGCCTCTTTCAGGGTATTCAATTCCAGGTGAAACGTGCTGGTCTTGATAAGACTATCC
GTAAGACCTTGCATAAACAGCATAATTAATGTGCGATAATTTAGTGGATTAGCTGTAATGAGACTCGTTACGTTTCGTATGTGGTGTATGTAAGAATGCA
CATTATACTTGCCTTGCTTGAGCTTCAAAGGTTCATATCGAGCCCTGAACATATCTCGTGGCGGTTCGAACGCTTGATTGAGCCAGGATTTGAAGACGTC
TGATGAGCTGAAGATATATGGGTCGTGCAACTTGAGGCCCAAGGCCCACGTCACAGCTCGTCCTGTTAAGTTCGACTGAGCAAATGCGACCTGAATTTTC
TCATCGACGATGTGACGAGCCCTTGTGGCATCGCCCAGCTCGACAAACCATTTCTATAAGGATTTTTCTTCACCTCCCTTGGAGATGTCAATCTTCAAGG
TTTCGGGTCGATGCGTGAGCGTAGCCCCGGAGCCAAAAGCCTGCTGCTGTGTCAACAGTTGGAACTGTTGAGCATCCTGTCTTCTCAACGGCTCTGTTTG
GTAAATTTTTTGCTGGTGAAGCAAGGTTGACCTATCCTGCTCCATGTCAAGTTCATTCTATATGAAGTTGACAATGGCAGAATATTGACCGTCTGATCCC
AGTGTGGGCAACTCTGCTCCGACGGCTTCTTGGCCAGTCGTCGAAAACATACGTTCGACGGTATCCATTTGGTTTGAATTAAATAAGAGTAGCTGTTTTC
ACGCGCGTGCGAAAGTTTTTCTCTTCACTATCCTACATGTTCATCTTGAATAGAACGTCGTGGTCGTTTGGCGGACTACAAAGTGCTACCAGGCATAACG
GTCACTCGGCGCTTGCACTGACACAGTACAATCTACTTACACTGTCTCGAGACTTCACGTACATGTACGGGTAGAGGAAGGCTTCAATAATAAGTAAGAG
TAAAAGGTGAAAAGTTGAACTGTATTTATAATAGTTAGTCTTCTTTCATAAATTCCTATTTCTTATAACAATGTCTAAATACGACCATGAACTGTAACTA
TCTGCTCACCTCTCATTGCACGCGCATGTAGTAGCTCGGCGTTATTGGTTGTTATCATGACCCTTTTCACCCAATGAGCAGAGTATTGCTATTGCTGCTG
CTATTACCGGCTAGGTAATAAGATAGGGGAGGAGCTCTGGAGCTCGCCCCATGATATAAGCATTTCAGTCCAAATAACTGAATCAAGTTACAAAACACTA
TACAACAGCAGTAGTCATTGAAGATCGAGTATGATGCTGCAAATATCTGAATTAAAACATTACAGTATACTTGGGCAACGCGTTCGGCCTGTGCTTATAA
GCGTCCAGCATTTGCTTACAAGATAATATTCACCTTCGATCTATTTTAAGCCAATCACAAGCGTGCGTCACAATAGTGACCTAGCCAAAGAGTGACTTGA
ATATGCATATATACCTATGAGATGGGGGCAGGCTAGATCGCACTTCGTACGGGTAAGCTACACCTAGCCGCGTTATTTACAGACAGACAGACAGAATCAC
ACACACACAGATAAGTACGATTTAAATGTTCGGCATTCAACCTTGCGCACAGTCACTAATAGCTTCACCATTCAGGCTCGCAATAATAATACGATGTCTT
TCTAACTTGATATTTACACCGAATATTTTCTTTACGTGGAACAATATAGGAGAGAAAGCTCTGGAGCTCGCCCTTTGATACAAGTAACTCAGTTCATAGA
ACTGAATTAAGTTGCAAAACACTATACAGCAGCAGTCACTAAAGATCGAGTATGATGTTGTAAATATCTGAATTAAAACAGTACAGTACACTTAGACAAC
GAGATTGGCCTTTGCTTATAAGCGTCCAGCATTTGCTTATGTGATCATACTCACCTTTGATTAATTTTAAGCCAGTCACAAGCATCCAAAGAGTGACTTT
GAACATACCTATACCTAAGGGGGTGGGACAGGCTTAATCGCACTTAAAACGTGTAAGGTACACCTAACCGCGTTATTTACTGACAGACAGAATCACACAC
ACAGATAAGTTAAAACGTTCGGCATTCAACGATGCGCACAGTTACTAATAGCTCCACCTGTCGGGCTCGCAATCATGTAACGGACAACCCCCGTTACAAC
AACGACGTAGCGGAGACCGAGAGATTCCCTACATTTATGAGCCGTATCCCATGTTGTTAGGCTACCCCCTTGTTTTTATGCGAGTCTCTTTTTTTAAAGA
TCCCCTCCTTGAATACCTGAAGCAGCAAGTGGCGTCATGTAAGGCGCCAGCGTCGATATTTCCAGTCCAGGTAAACTTTTATTTGCGATGAATCCACATG
CCCAATAAGTCCACTATTTTATTCATCCCCATCCCCCTGTATTTTGAACCCCTTCCGGAGTCTCGTATTTGGTCAGATCCGGAATGTGCACGACTCTCAC
AGATTAGCACCCAGCTCCAGCTGACAGTTGAATAGTTACTACAGAAAATACTTCCACATACTTGTACAGTGGCGATCTTTACCACTGTACAAGTATGTGG
AAGTACTTTTCGGAGTAAATGTTCAGCTTCAATCTTTGCCGGTCTTATAGGAACCATACAAGCGCCTCTGTAAGCAACAATCCCCTTACATATCGTGAGT
CCGTATATCTCGATGTCTGCGTAATACAAAATCGGATGACATAGATTGTCTGCAGTTAATCCTGAGCGATCTGAGTAATCACTGAACCTCTTTCGGGCTA
CTATAAGACAGAAATAAAGAAATTTCAAGACGTGGTATGTCATAATCCACCGTCTGTATTACCTCCTGATAGATGCGTACGTCATGAAATTGACTTGGTT
CCTGGAACCAAATACTGCGTTACAAGGCAGTGGCCTTTACCAAAGGAACAATGTGACGTCATTGACGAGTTTTTCTGTGCTAAGCACGCGGCGGGAATGG
TGCAGGAGAGTAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAACCTAATGGTAAGTGGCGTATTGTACACGCTTATAATAAGCTCAATGCGGC
TACTATACCGCCACAAACACCCATTCCTAGAAAGGACGTTGATGATTATTATCAACTGCTCATGCGAGCAAGTGATATCCCGCTTACAGCGGTTAGTGGT
CCAAGCGGTATGCTTTGGGAGTGGCTGGTT