Description :
From Genome Similarity Track
Location :
Scaffold_37:286693- 289635
Sequence
2942 bases(100 bases per row)
CAAGTGACGTTTCCTAGATTGGTTGTTGCCTTCTATGAGTTAGATCTACTTGACTTTCAACGCCAACATCGACAAGCGGACATGAGTATAGTCACCTAAT
GTTAGCACTTCTAAGCTGAACTCAACGTTTTACTAACCACACTGATCGTTACAGTGAGACTCGAACTCGTGGTGGTCGCATTGTTGTCGGTACATTCGAT
GCGTCTAACGTCACTGGAGACGACTATGGGAATGCGGCGGGTGGTACCGGTCTGTACAACGCATGGAGCACTCGTGATTGAAGAGCAAGTCGACGTTGTC
GGCAAACGAGCTCAATGTTATTAGAGGTTGTCGTGTCACGGCAAGATTTCAGAATTGTTGTCACTACTACGACGTCGCAGCGACGCTTTCGCGCTCCGTG
AACGGTGGTACACTTTGTGCTCGTTATCGTTATCGCAGCACGGGAACCTGTGAGTTCGTCCGCATTGCCGGACGAGTAGACCACGTAGCAGCCCAGGAAG
CCTCGCCCGACGACGACGGAATCTCCACGTACATCGGGATTTCGTGCCACAACTGTTTGGGCCAGGTAACAATGGGCAGCAGGATATCAATAAGCGATAC
ACGGGTCGGCCACGATGCCCATCAGGTCGAATAATTGGCCTTTTGAATGGTTGAAATCACCAGCATGTACAACATCTTGGACGAGCGGCGGTCGTTGCCA
TCGACGGCATTTTCGCCGGGTGTGTTCGCGGCGGCGTATCCATAGGATAGATGAGCGCGTTCTCGACGTCGTCCTCCTCCTTCATCTTGAGGTTCAGGTG
CGCGGCAAAATAAATGACCGGTTTCAGGACGACAGAGAAGGCGGTCGTAGAAGCAGGTCACGACGACAACACTCCAGTTCGACTTGAAGCCCAACGCACA
TCAGGTTACGGCAACTCCCCTCGGCCTAGTACGCTGTACTGGCCAGGATCAGGAGCAGGCACGACAGGTTGCCGAACGTGCCCGCGATCTACGACAAGAG
GGACGATTCCAAAGCTGCGACGTGGGTGAGGAAGTACATGTAGAGACGTCAGGGGGCACCTGGAGTTGAGACCGTGGACACCGTCGTGGAGGAGTCATCG
TGGGTGTAGAGGATTCCGAGCCAACACCGCTGTTCACAGTGATGCGCTTCCCAGTAGCACAACCTAGATTCGTCCTCGCTGATATACACACCATACCGGT
AGTTTTGTTGCAACTACTGGCGATCTCCTTCTCACAGCGGCAGAACCTCACTTGGCCGATAGAATGACGTCGCTGTGGGCGGAGACCGTGTCCGTGGTGT
CCCTCGTGAGGGCGAGCAGTAATGGCCCCCTTGCCCCAAGAGGTGGCGCGAAAGTGTCTATTTGCACAGCATGGCTAGAGGCAGGCATCCCGGTAGGAGG
GGGAGGTGAAATGCAATTCAAAGAGGGTCGCTCCTGCGGGGAAGAATTCTCGCACCTTGTGAATTCAATGCTCGTCTCGTTGAGGAGCATGTTGCCGGAC
CTGGTTCAGCAAACAGCGCTTGGCCCTGCATCGTAGGCACCCCACCAGGCTTGTATGGGCTCGCTTCACGAGCGACTGCTTTTGTGAAGCGCACAGGCTC
AAAGTTCATGACAGTGCATGACATCCGTCCTCCACATCCCAAGATAGAGCTGTCCCGTGCGGTTTCCAAACCAGCACAACGGACTGGACAACATCAGAGA
GTAGAAAAGGCCCACGGGAAGTCTTCCCTCCCGAGCAAGCTTGCATTTTGACATATGCGCAGGGTGGAAGTTCTCGCCGCCGCCATCTTTCATGCATGCC
TCCATCGTTGCTAGGAGTGAGAGAAAGGTGTTGTTTAGCGTTGAGCTCGGCAGCTCCCCAAGCTCTTCTGTCACCGCCATCACCAGTTCGTCCAGCGTTC
TGGTTGTCTTCTTTATCTGCCATGCTTAAATTGCATTGAACACCCCCAAGTCACAGACATTCAAAAGGATGGGCGACATGTGAAGTGTGTTCCCAGTTTT
GAAGCTCGATCGGCTGTCGACCATTCATCGACGTTAACGCGCACAGCATTCGAATCGCCTTGCTCAGAGTTTCGTTTTAGCCCTTCTAACGCACTTATTG
ACGAATAAAGACCAATGTATGCGGTTTCCCGACAGCTGTTATGGATCGGAGTAGTATCTCGGGAAGGGAATGGTGCAGTACCGGTACTGTATGTCCGTCG
GATGCCCTCAACTCAATAGGCCCCCTTCAAAGTGTCTTAGAAGCCCCCCCCCCCCCCCCCCCAACGCGCACCAGAACGAAGTTTTAAATAGGACTGTCAC
GAGATTTCCATGAAGTCTCGTGAGGTATCGAGTACAGATGATGATCCAGTGCAAGCACGTAGTTCAATAGGCCTCAGCCTTAACCTGGGTTCAGACCAGC
GACAGCAGCAACTTCAACAATTATCGAGACAGTAGTGAACCCAGGTAGCAGAGAGTATGGGTACGAACCTGAGTAGTGGGTGAGCGAGCGAGCTCATTCT
GGAATCTAAAGAAAAGGAATAAAGTCGACTCCTGCTCTGGCCAAGCAGACGTGGGCTAACGTGTTTGGTGACCTCGAGTAGTTCCTCGGGCACCTTAACC
ACACTCTACCAAGTGCTTTCAAGACGTGATCTCGGGCACCTAATAACAATCTTCTGAGTGCTTTCAAGACGTGATCTCGGGCACCTTAACCACAAAATTC
CGAGTGCTTTCAAGACGTGATCTCGGGCACCTCGACACACAAAACCAAGACTTCCTTTGCCTAAGTGCTACCAACTCCAATCTTCCGGCTCACTACCAGT
GAGTTGGAAGATTGCGACATTGTAGAACTTGGCTTCGATGCAACCAAGAAATACAGCGCGAAGAATGTTGCGGAGCGATACCGCGCCAGTGCGGCAGCAG
CTGGATGGAAATCGTCGCAGCGCCGAAAATGAAAGGATTGAC