Description :
From Genome Similarity Track
Location :
Scaffold_607:2866- 4123
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_607-snap-gene-0.7GF22253

Sequence
1257 bases(100 bases per row)
AGTCGCGCTGGTTCCTCTTCTGGCGCGCGCTCAAGTTCCTGAGCCAAGTGCTGCTGGAGATCGGGCGTCGCGGACTGCGGCTCATCGAGCGCAGCGTGCC
GCAGTACATCGCGTTCGTGGACCGGTTTCTCGTGCAGACCATCCGCGTGGGCCNNNNNNNNNNNNNNNNNNCCCGATGAAGCGCGGCCACACGCTGCGCT
TTGTGCTGCTGCTGTGCGTGCTGATCACGATCCCGTACTTGATGTACAGGATGCAGCGCATGCAACACGGCAACTCCGTCGAGATCATGTACGTTGTGTG
CAATACATGTGGAGAATAAACGTGGTTTGAGGCTGTTTACTTATTGTAGTTTTCTTGCTTTATGGAGTAGAACGCGGGAGCTGAACGAACACAAGATCCG
TCCGCACATCATCGTGGACCGCCTGACGCTCGACCCCGAGGAGACCAAGCGCCGCGCGTTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
CGGTGGCGACGGGCTGCAGACCGACGACACGTTGCAGCGCTGCGAGAACACCGTGCAGGGCGTGCATATCCTCACAGACTCCATGGGTACGTCCTAAAGT
TTGCAGCATGGTGGTTGCCTTGGCATGCTTGTGTGTCCTATTTCGTGCACTGACATGCATTCTACTGCTGTCCTTAGGATACGTCTGTACGCGATCACAG
CAAGACGACAGCAAACCCGGTTGCTGCAGTGAGACTGACACGTCGCTGCCACGGATCAAGCAGTTCACATGCGACCGATGCGATACGAACCCGCCGCACT
GCTGCGACGTGTTTGAGCACTGCGTCTCGTGTTGCATGCATCCTCTAAACGTACGTGCGCATGCGCATTTTGAGCATATTTCTTTTTTCTGTGAAGAAAG
ACTGGTCCGAATGTGTCCTACTTACGCATTCTTGTAAAATTAGGAAAACATTCGTCGGGATTATTTAACGCACGCGGACGCGTCCCACCCCCTGTATGGC
GATCCAAGCAAGCTCACGGTCTTCCGCTACTGCAAGTTCCGATGTCGGACGTCGTCCGCGAGTGTGCAGCACCAGAATTCATATCGCAGGTGCGCTTTCT
CTTCCGCAATTTCCGTCTGTTGTTCGCTTACCAAAGCGCCACGAACAAACTTGTTGACGCCAACACCTGTGCGCTCACTCACTTGCCATGTTAGCCACCG
AACGTTCTGCTACGGTATCCACCGACCACTGAAAGTGCTGGCGACTGTAAACAGCGA