Description :
From Genome Similarity Track
Location :
Scaffold_970:2866- 3931
Transcript NameFunction/comments
g9944.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
CAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGA
TTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCG
TATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCG
TCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGAC
GGCGTCGACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCA
AAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTA
ACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCT
GTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGAC
GGAAGACCCGGAGCGTGTCCTGGGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAG
ACAATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGG
TGCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGA