Description :
From Genome Similarity Track
Location :
Scaffold_188:28656- 29762
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.18CG12753-PA, isoform A

Sequence
1106 bases(100 bases per row)
GCGGCGCCGCGACCACGAGCACGACGCTGACGGACGGCCGCTTCTTCGCCGGACGCCGCGTCGAGTTCACGCTGGCCAACTTCCGCCAGCTGCACGCGCA
GCTGCTCGATTTTGCGCACCTGCCGCCCGCCGAGATCGTCGAGCTGCTGCGCGTGCTCTCGGAGTTCCTCATCTACTCGGACCAACACCGCGGCCGCGCG
TCGCCGTCGGTGGAGGGTCCGAGCGACAGCACTGGGTCAGGACCAGTGAGCGAGAATGGGCAAGGCGCCGCCGCCTTCTTCGACTACTTTGGGGAGAAGA
ATGTGCTCGCCTTACTGGTCGACATGGGTGCCAGCTCACCGTCCGTGCCCGTGCAGATCCAGCTGCTGCAGACGCTCAGCATCCTCGTGCAGAACATCGC
GACGCGCACGTCGCTCTACTACATCCTGTCCAACAACTACATCAACAAGCTGCTCGAATGTCCCTTCCAGTTTGAGCACGACGACGTGCGCGACTGGTAC
GTGACGCTGCTCAAGGCGCTGTCGCTGCGCCTGAACGAGGAGACGGTGCAGTTCTTCTTCGACTCGGCGACCGCGCGCTTCCCGCTGTACGCGCGCGCGT
TGCGCTTCGGTCGGTGCAAGGACAATATGATCAAGGTGGCGGTCAAGACGCTCACGCTGAACGTGCTGCGCGTGCCGGACGAGCGCGTGCGCTCTTTCAT
CCTGCACTACGATGAGCTCAAATATTTTCGCGACATCGTCGAGTATGCCAATGACGTCGCGCTGAAGATCCAGGGTTTGCTGAACGAGTGGCCCGAGACA
ACTCGAGTACCGGCTGCAACGAGCGCGCTGACCGAGAAACTGGAAGAAGCCATTGACGAGTACATTGACCACTGCTTCTACCTGCAAGACATCCTCGACG
TGAACGTCCCCGAGTTGTGCTACAAGGTCGGAGAGTTCCTGTACATGTTGCACGTGCGCACTCTGTTGGCTGCGAGCGTGCTGCCGAACTGCAACCCGCC
ACCTCAGCGGGTATCGACTCGTCTCGCGCTGTACCTGCTCACGAGGATGCTGGGCATATTGGAGTATGCGCCGCTCGTCAATGCCGTCGCCTTCATGTGC
GTTTCG