Description :
From Genome Similarity Track
Location :
contig_61:28649- 41285
Transcript NameFunction/comments
g9182.t1hypothetical protein

Sequence
12636 bases(100 bases per row)
GATCGGATCTAGGAATCTCTTTGCATGACAAGCGCCACACCAGCCAATATCCACTTCGCCTTGGGATGGATCGTGTTCAGTGTAGCAAGGAACACGTACG
TCGGTCCTCGAAGTGTTGTCTGATATACAGGACAATCAAACACGTCCTTGCTACGTCGGAAGTGCCCCACTGCCGTGGCCTCCCATTTGCTGTCAATCAC
CACAGCTCGCGCATAGATTACAGGTGCAGCTGGAAGCAATTCCTTTGGCATCGGATCCACTAGATGCCCGCCACAAGGAATAGAGTCGACCTCGTATATA
AACGGCGACGTTTTGTCGCCGTCTTTCATGGGATATTCCCACCGCGCGCCCTCCATGAACAGACCATGAATGTACGCACCCATTTCAGGATAAGATTCGG
CCCCCTCAGCATCGGCAATGGGTGTAACATGAGTCTCAATCGCCATGGAGTCCAGTGGGATTCCGTGTGTTCGCGCCGTGCACTGCTTGATTGCAGTGAG
GAAAGCTGTTGGATTGAACAAGCCCGAGATCCACATCGAGTAAGGAAGGCGGAACTCGTTTGTCCAGCTTGAAAGAAACTGGCCACGCTCCAGTAGATCG
GCAAACCACAACGATAGCGACTTCGCGACCACCACGCGTATCTCTCCCAGGAGCACATGTGCAACACATTACGACCAGGGACTTGGTTGATTGAAAGCGC
CTCCATGAGGTCCTCCATCTGCTCTGTCATGTTCAGCGTGCCCTGAATTCCTTTCGTGAGCTCGACGAGACTGGTTTGAATCTCGTGGAGTAGTGTGTGC
ATGCGAGTAGCTTCTTGCAAAGCGACTACAACGTAAGGAGATTGATCGGTTGTCAGCAATGGATCTGCCTTGGCTTGCAAGTCTGCAAGATCAATCTCTG
GTGGAAGCTTCTCAAGCAACTCTTCGATAACGGCATAGACGTGAGCATTTTCTTTTGCCAACTCAGATGCTGCACTCCGTGCAGTCTTAGTCGCTGTGCC
ATCAGCAGACGTGGATGGTCCTCCTGATGGCTGGAATTTTGCAATTGCCGCGAATAGTTCATTGGAGGCGTCCACGAGGTATCCTACCTCCGCGTTCGGA
TGCAATCCGTACACCGTTGGGGATTCACTCGGCAGCTGTGTTTCGATATGGTCGACGTACTTGGTATAACTAAAAGTAAACGGGTCGGGACACTTAAACC
CAGCAGTGAGTTCTTTGCCGTGGAAAATGTCTTTTGTAAAGACTTCGTTCAGGTAGGTGTTGTTCGTAATCCGGTCCCAGTGATCCGTGATATGGCCACC
ATACATAATTTCTCCAAAGATGTAGCGCAGATCGTCCCATGGCAAGCTCTTCGATCTACTCGTTGCCGCAGTATCAAGGTACCGTCGAAGTACATCCGAG
CAGATAAGTAAGTCCCCCGTGTTGAAGCTGTACGGCCGACTCCAACCTTGGCAGCCAAACCTCCGCCGTCCTAACACCAGCGCATGGAAGAAGCATAAGG
CGAAGATACATCCTTGGTATTCGCTGGGCTGAGCACAAGCGTCAAGCTGCTTCAGCGAAAAGTTAGCCCAGGCTCGACGCAAATTACTCTTCAAGTCAGT
CGGCGCCTCATTTGCAACCTTGATGCAGCTTTGTAGAAGCGACTCTGGAAGATTACTGAGTGAGGCCAAAGCTGGGCCCTCGGATGAGAGAAAACACCGG
AAATTCTGATCTGCAGATACAGAGTAAACTTCCAAAGTTCTCTCTAACCTCGGGAGCCATGACTGCATCAAATGGATGTTCTGAAGAATCACCCAATTTC
CTTCTCGAGAGAACTTCATGAGCACACTGTCAGCGTATTCCTCCTGGCCTTGACCCATAGAAATGTTGATAAGATTTCCCCGCTCGTATGTGAAATCAAA
CTTTTTGCCAAGCGTCTCCACCCACGAGGTTGGGTCCACGCCAGGAAATAGCACGAAAAACATCGGCGTTGAGGCACTCGTTTCTTGGTAAGTCGCCTCC
ATGTCAAAGGGTGGCTGCTGAACCATCTGCTTACCAAACGTATCACTTAGATACGAGCGCAGAGCAAAGATCATTCGATCTGGCCGGAGCACGCGTACGA
TGTGCAGCAACTGGACTGGCGTGACCGAGGTTTTGTATTGTCCGGGGAGAGGTTTCACTTCGGGCTTTTCAGCATCACACCATTCTCGCCATTCCTCACT
ATCGGAGCGCATAAACGTTGTGAGCTTCTGGAGGCTGTGTATATTTCCTCGAGTTTCCGAACGCGAAGCCACATTGTTTCAGACAACCACTCGCTAAGAA
GTCCCATCCCTGACCCCATGTCACTTGCAGTACTGCAGGTCACTAACTGATGAACGTCGATCGCATCGATTTTCTTTTCCGACTGCAAAATCGAAAAACA
CAGTTGAGTGGCCAAAGTCAACTTGTCCTTCTCAAAGAGCCCCCGACGTATATAGTTGAATACCACGTCAGTAATGGATGCATTAAGCTGCGTACACCGG
GCCTCGATTTGTGCTGTTGAAGGCTTTTCTTCCTGGTCCGTTTCCTTCATGAGGACGTCTAAATCTTGTTCGGTGTTAGTGTCCATCACCCGATCCGCCA
GGAGCAAATCCGAATTCCACTGAAAGCGTTGCGATACAATAACCTTTTTTGCCGCTGCCTTCAACCGACTAAGCAAACCTCCGCCACCCGATGAAGGCGG
TCTTCCAGGATCCTTCTCGGGTTGAACCAAGTCAATTCCACGCTGAAAAATGACGACGTACGCGTTCAAAGAGTACACATAGTATGAGTGCATACGATGC
AAACCATCCATGATGAAAAAGAGCAGTGCCCCCCGACTTGCCACAGATTGATACTTCGCGCTCAGCTCATTAATTTGAGCTTCGTACTCGGTGGCTTTGG
CGGCTTTCTTTGCGATTTCTTGTGAAGTAGCCTTTGTCGTTTCCAAGTCCGTGATTACCTGCACATTCTCCGTCACATCCCCCTCGGCATCGGCAAGACT
CGAAAGAATACGATCTTCCAGCGTTTGTATCCGGATTTTAAACTCGTTCTGTTGGTGAATGAGAGCTGTACGAACTTTAGCCATTTTAGGCCACTCCTTG
CGCACTACGAGAGCCAAAAGCTGGTCTTCAAGGCCTTGTTGCGTAACAGCAAAATTGATCATCGTAGTCTCGGCTTGCAGCTCAGGTGGGTAGTGAGGAT
TCGACAGCTTTGTATGCAAATACAGTCGGAATTCAGGATGTAGTTCGACAAGTTTATCACCCATTTTCAGTAGGGTTTTGCGGCCTCGTACGGTGGTAGA
CCGAGAGATCACGGGCCACATACACACCTCCAGTTTCTCTCCCATATTTTCAACTATCACTGTGTAACCGTGCTCGACTGCAGTCTCCAGCAGTTGAGTC
AAGTTTGGTTGATCTTGACGTACTCTGCAGGGAGCTAGGTGCCGCCCGTCGTGCATGCTTCTCCATTTCACGAAGCCAATAAATACCTTGCAGTTGTGGG
TCGATTAGTAGTGGTGAACGAGTACTGTTGCGCACTATGGCACCATTTTCGACCGAAACGCGATCGCTTGGAAGCCCTTTCGTATTCCATTCTGCAATCT
CTGAAGGCGTTGCAAGAATTTGTAAAGGATTACCATCTTCTGACATTGTGCTTATTGCAGGTGCAGCCTTATCCTTATCTTTGTCAGCTTTAGGTGGCTT
TTCAGTCAGCGCTTTACGAAGGAAAGGCAGCCACTTGTCGTTGATAAGCAAATCTCGAAATGGCTTTGTGAAAGCGCCAACATACGAAACAAAGCTAGCA
GCTATCACAACGTCACAGACCAACATTTCGGCACTTACGCGAAGCTGCTCAAGTTCATGCGCCCAGCGTTCACTCTCACTTCCGAGAGCCTTTGCTAATC
GACGAGCAAGTTCCATACGAAGGCGACCCCTCTCCAGCAATCCCACTGCGTCCTGGACCTCCTTATTTGTCTTGTCAAATTCTTCTGTCAATATGGCAAG
CTTCTCCTCCAGCGCCGCTACCTTTTGATTCACCAACTCCAGCCTCTCGTTCGCGACCCGTAGTTTTTCGTTAGCCTCTTCTAATGCTCGCTTTTTGGGC
TCAACCACCACAATGGCATCGTAATAAGCCACGATATTGATTACCCAGGCACACAACCCAGCAGAGGCAGAGTTTTTCTTCTCAATTGCCTCCACATTGA
AGTGTTCAAGCAGTAAAAACGGACGGATTTCCTTCCAGTTGACCTCAGGTATTTGCTGGTTATCCACCAGCGTCTTGAATCCTTTAAGTTCGTCGACTAA
CGAGTTAATGTTTCCCAGAAGCGCTTTCTTCGTGGCCTCCCATGATCGATCCTTGTCTTTCACCTTGCCATTTTTCTGGATGATCACATTTGGATTCACG
CCAGCAAAGAGCACGACTACAGCGCCGAAAACGTCGCCTACACCTGCAGGAGGCTTCGCCATTGTCTTGCAGTTTCCCAGATCCTTTTTATTTAGCGTGT
CTAAAGCCGCCATCGCAGCCTCCACCATAGGCTCGGCTTGAGCAAGATCCGCCTCGGTGTCCGCCTTCTTTGCAGATACATCAGTCTGGATAATAGCGCA
CTTCTCGCGCTCAACGTTTGCTTTTGCTGTCTCGTTTTCAACAAGCTCCTTGTCTTTTTGAAGACGTGCTGCTAACTCTTCAAAATAACCTTCTTGTTCT
CTGCTTCTTCTAGCGTACGTTTCAACTCTTCCTCCATGGTTGCAACGATTTCTCCTGTTGATTCCATCTTCTCAAGTCCGCTTTGAAGGCGTTGCATCGC
GTTTTGGTGTCTGGAGTGCTTCTGGGCTAGTAGCCGACGATACAGTGTCAAACATTCCAGATATGACTTCGGAGTCGAGTATACGCGACGCTTTTCACGT
GCGAAAAACTCACTTGCTAATGTGTTTGTACTCTGAAAAGCGAATGGCATGAAATTTTGCACCGCCATCGCCACATTTTCTGCGGAACTCAACTGTGGAA
TGTTATCAAGGAAAGGAAGCGCGCAGAACAGACCGCAGCGCTTCCTTAGGCCATGGCTGAAACCAGTCGATCAACGCACAGTTCACTAGGGCAGGGAACT
TTCGAGTGCATTCGGAAGTCTGCCGTTGCCGGAGAAAACAGGGACAACATGTAGGTTGCGCTTAATTTCCTGGACAAGCCATCGCCATGCACGCTCTTTT
TCAGACCCTTCGGTTCCAAGATTGATAGCTTCATTACCATCGCCAGACGAATCTGCCGCGGCACTTGCTGCTAGCGCTGCCACCATCTTCGGCTGGAATT
GCTGATCAAATTGGTCTGCTCGTCAACATTGTAAAGATCTGGTATATTACCACTCGACAGCAAGTCGTTCAGATACACGAGCATTCGCTCATCTTAATTT
GATTGTCGTCAAACAGGAAAACTAATCCGTCACCTTTGACACCTGCTTTCATGAACATGTTCTGAAGATCGGATTTGAAGTCCAACAGTGAATACGCTTG
CGTAATTGTGATCTCCACCAGAGCGTATCCACAGATGAATGTACTTAAACGTGCCAGTGACTTGCGGCCGCTTCCACCAACACCGACAAGAAGCGCATGA
CCGGATGGGTTTGAAATAATGCGTACGATGCGGGTAATATGCTCGAGTGCGTCCTTGAACAAAACCAGGCCCATTTTCGCGTTTAACTCATTGTGTTCTG
CCAGCGCTTCCTCGACGGTAGCATGAAGAACTTGGAACGATACCACCTGATCGTATTCATTAGTACGCAAGCCATTTGCAAAATGACAAAAGAGAACTGG
GTCTGTTTGAAGTAGTGCCGAATCGCTGCTGCTCTCTGTGCTAGAAGAAACCGGGGCAAAGTAACGCATAAAGTTGAGAGCGGGAAAGCATTTTCTAGCT
TGCTGTTGCACAATCGATGTGAATTTGGTTTGATCCTGTGTGGAAACCATGCGGTCTCCGTAGACCCGTGCAGATTCATACCCACAACAACGCGAATTTG
AGCGGGTCCTCAAATGTTGGTGGTTTTGCCATCAACAGTCCTTGGAACACGTTCGCTACATGTCGAATATTGAATTCGTAGTGAAAATTGGCAGCAGTCT
TACGAAAGGTACTGCACACTTGCACGTGCAGATTAAGCGCAGCTTTTAGAATTGGTTGGCACATCTTGCGGATATCTTCAACGAAATCGGCAACATAACC
CTCTAGAAAAGTTGTATAGATAACCTGTAAACTGGCAGCGCTCAACTGAGGCAGGGCAAAAGTAACAAAATGCCGCTGTAGACGCGGGTTGATGCTGAAG
CTCCCGGCGTTGGGGTTCATGCAACTCAGGAACTGCACATCCACGATCTGTTTTAGTGAAAACTTAGCTCGATCATACCAGTGTCCATAGTCCAGATACT
GACGAAGCAATGCGATGGCACTCTGCGTACCATACTGATCCACCTGAGGAAGATTTAAATCATCTAGGAAGTATATCAACTGGTCGCCGACGGTTGGACC
AAAAGTAGAGCCAACTCGTTTTGAAAGCTTCGATTCGAGTATTGCTTGTAATGCGAGCGCATTTGTGTAGTAGTTGAAGTTGATACTCATACTGGCTGCT
GGGCCTTTAGTAGCGACAATTGACGACGCTGTTGGAGCGGAGGATGAAGAAACAGCACTAGTTTTACCTCCTGAGACCCGACCATCTAGATTGCTGAGTA
ACCCCTGCACCAGCTGTGTCTTTCCTGTGCCCGCATTGCCACAGAGCATGAAAGGACGCTGCTCATGAACCATGATACTCATCCAACTTGTAATAGAAGC
CGTCTCAGGAGTAGATACCGTGACAGATGACATGGCAACAGATCCATCGAAGTGGACTGCTTTAAAGTACGGCGACGCCCTCCATGTGTCGAACGTTAGC
GTGTTGGGGTCAAGCCAGTAATCAAACACAGTGTCACGAGCAGGGAACTTGATGGTCTTGAACTCACTTCGCCACCATTCGCTAAACAGCTTGCGATAAT
CTGTTCCATCGTCCGTAATTGTGAGTGCGGCACCAAACGCCCAAACTGATATAAAACCACTCAGGATATCCACTTTCTTGGAATCTCGTAGGGTTTCTGC
GTCCAGCACTGCATCAAGAAAGTACAAGTAGGTTTGCACCATAGTTATTTCCTGCATTGGTACAATAGTCTTGCAACATTGCTTAACAAACGAGATGATC
GGATCGATGTACTTATTCATAGCCTCCCCCAAAGCTGCGCGTTGCTGTACAGAGGTGCCCTTAGTTGCCACCCAGCTAGCCAAGAACGATCTCCATTGAA
AACCATCGTCATCAGATATATAAAGAATTCCCGCACGAGATACTGTCGCAGGGGTTGCATACTTCAGATCCCGGATTTCAAATAAGAGTCGCATGTTCGG
CTTCAGCGGGATGCGCTCATTCGAAGCAAGCGTGAGCATTTTATTGTCATCCATGACAGAGTTCATCGACTCAATCCAGTTAGCGTCCAGGTCTCCATCC
AGTACAATCCATTTCGGGCGAGGGTCTGCGACCGAACTACTAGCCACGTCGCGCATGATCTTAGACAATAGACCATCTTTCCATTCTCGTGTACCAAGCA
CCATATATCCATAAAGATCTTCAGTAGAAACTGACTTGGGGTTGAGGTCAATGACTTTCGTCGTGTACTGCTCGCCTTTCTTCTTCCGAGCAGCAATAAG
CGTCTCACAGCACTCCGTTTTACCACTTCCCGGTGGCCCCATCACAAAGACACAGTGACGAATTGCTAGCAGCTCTTCCAGCTGAATAACTTTCAGCCGG
AACTGTTCATGCGGCCAAAGCCCGCGATCCTCGCACGCAACGTGAACGTACTTCTCCATCACCTCGTCGATCTTCCGCGGTAGGTTCAGGTTGGGGAAGA
GATCACCAAGTAGCCCCGTGAATATAAGTAGGTCCTGTTTCACGATTTTGGGCAAGTTAAAATCTCGAAGGGAGCGCATCAGAATTTCTTGCTCGGAAAA
TTTCGGCTCAGCACGCTTAAAGGTACCAGCAACGACGAGTACACTTTTGACAGCTCGAAGGCCCCAGTCATAGTGGTCTTGTTTAGAGAGAAGCTCTCGA
AGCAAGGAATATAGACTAAAGAATTTCGTAGCAAGAAGCTTCGCCTCTCGGAATCCTTCTGCCATTAGCATGTTCTCGCAGATCAACACGAGATCGGGCG
CCATCACTGTAATGGGTCGGAATAATGCTTTCAAGCCTTCAGGCAGTTCAGAACGACCGAGATAGCCAGGATTCATGGTAATGAATGTCCCGCATGTGGG
ATCAAGCGTGACCGAGTCTCCTTCAACCACAACATGACTGCTTTCGCCTCTAATTCCATCGCAGACAGCTTTGAATTGGACCGAGCACACAGATAACACT
TCAGGAGCGAGACGGTTGAATTCATCAAAGCACCCCCACGCGCCTGCACTCGCTAAGCCTTTGAAAATGTTCCCAGATTTTTGTAGTCCATTTCAGGGGA
GCAGTTAAACACATAACATACTTTGCCTACCATATTTGCAAGATCTTTCGTGGTTTCTGTTTTTCCTGTTCCGGCAGGCCCTGCTGGAGCACAACCCATT
TGAATGTGAAGAGCCTGGTGGCAGTAACATAAATTCTGTCAGTCAAGGGCGTGATCACGAGCCTCGGGCCATTGCCCAAATACTCGAATCCGTAGTCGAA
TGTTGCGTCACAGATTTCCAGATATGTGTGATTCTGATGATCTGACCGTCGTGGCTTTAACTGCGACTGCCAAAGGAACGAGCTAGGTATCGTGATCTCT
TCATACAACAGCTTCTGCACAATATCTCGTGAATGCGCATCCATAGTGATCATGCACATTGTACGTTGGCGATCCCCTTTCGGCAGGTTCGTTTGAGTCA
GCTTAATCAAATCGCTGAGCTGAATCATAACTTTCTCGAGAAGCTCCTTCATGGCGGTCGCATGACCCTTTGAAATAAGCTCAAACGCATTTTCAACGCT
TCTTACGTATTCAATGCCAGCGACAAGCAGTGCAATCTGAGCGGCATCCATATTATCTTTCGATGCGCACCCTCACTAACTGGTGCAACTTTCTGCAGCA
ACCAGTCGACTCGATTTTGCTTAGGAAACCGGTTGATTGAGAGCGTAACATGACCCTTTAAGGTGAGCTGTATGGATTCCAGTATCGTTTGCATATAAAG
TTCAACCTTACCTTCCAACGGTACCATGTTCTCGAATGAAATGGTCTCTTTCGCAGAATCGTTGGATATAAAGTGAGTGGCAAGCATTGAACTAGCCGCT
CCATTATTGTCTTTCTGTAGGAGCAGCGTATGTGTAGCCAAGAACACCTTCTCGAGGTGAATCATGATCTTCTGCGGACTGCTTCCGTTCGAAAGTATGT
CGAGCAAGTCCGCTTCTGAAATGAAATAGAAGCGCGGGAACAAGCGGCGCTTGGAGTCGAGATACTCCTTTAGCGCTTGTTGGCACTTTTCCAATCGTGA
GCGAAGATCATTTAGCAGTTCGAGCAAGCTAGGAAGCTGGCAGGCAAGCAGTACATTCCCAGGTGGTTCCTGAGCCCACATCTGTTGCAGTGTTTGGCGG
ACCAACTCGTCCACATCTTCAAACCTCGCCGCCTCGTCAGGCAACTCCGTTTAACCTCCTCTGACTGCATAAAGAGCGGTTCCAGATATGACCATGATCG
CTGAATATCTAATAGGGCTCCAACTGTTTCAGAAACAAGCATGAGCTTTGATCGCCATAGCTGTGTCTGCTCCTGAAAAAAACTATTTCGCCCAGAAGCC
ATTCCTTGTATTAGCAACTGGTCCGACTCAAGCATCTCTACATCGTCTTCCGCCATGTGTAGTAGGGAACTGTCGTTTCCTTATACGGAGTCATCGTCAG
GCAAATGTTAGACCAACGATTTTCAAGCTCGTACAGAGTTGATTCTTGTTTGGCTTCTTTTTGAGCTCGATCTGTAATTTCTTCAACATCCCGCTGGAAC
TCGTGGAGATTTAGTGCTAAAATATCTGCAAATTTAATGGATGGGTTATCGTCCGGGCAATCGAACGTCTTTCCTGAAACTGCAATCAGATCTTGCCAGT
GACGCCTTCGCATTGATGGATGCCGCAGAGCTTGAAATAATGGACACGTACTAAGAAAGTCCTTTACTAGTCGCTCAAACTTTTTAAATGCGTCGCAATC
GCGAATGTCTTTGTGTGTAGCTTTTACCAGTGATAGGAAAGTTTTCGCCTCTTCTTCCAAAATAATACCATCAATCATGCTCCACGGAATATCTCTTGAC
AAATCAATTTTCCTTGTTACCTCTGAAATGGCTTCCCACAATTGATTGCAGTGGGTAAATGTCCTCTGGATAGACGCTAATACGGAGGCACAAGGTCCAT
CAGATCTTCGCACTCCAGAATCTCTGCAATATGCTTCTTTTGTTGAAAAAAATCTCCATCTTTTTCCGCATTTGCCTGCTCGCCAGAAAGTAGTGTTAAC
GCCGCGTTGACACCAACAGAAAAGTTCCAGAATGCCTTCGTTTTAAGCTGGGTCTCCTTTGCTCGCAGTTCTTCCATATAGACGGCAACCTCGTCAACGA
AACTTTAAGCTTTGCGTAGCAATCAATGGTGCGATACGATTACTTGCCGCGGGCACCTTCTTCAGTACCTCCCCCCAAGCGACTTCAATAGCCAACAGAA
TGTCGAGCTCCTTGGTGACAATGATACCAGCATCTTTAAGGAAGGCGATTTCCGCACGGAGTTCCTCAATTGATAAAGATATCGCTTCTCCGCGTTTCTC
AACCATAAATACGTGTTCTTTCAGTCTGATTAACGCAGCTGTGACCTGCTCAGGAGTCCAGGTTGGGTCCGACAAAGGCTGCTCCAGCCCAATGTTGCAC
TCTCGTGTCGACTGCTGAAGCCCCTGTAAGTCATGCAAGACTTGGTCTATCACGAGCTTTCCCGTCATTAAATTCATCTCTCGGGTAACAATATCATCGA
AAGTTGCCGTGTATGGTGACCCGCGAATAGGCCCTGCGTTTCCACCAAATGTGCCCTGGAATTCTTACCTGGTACTCACCAGGGCTCGGCACTGTGTAAC
TTACAAGGTACTTGCCGTTTAGAAGATCCTGAATCTGCAAACTCGGCAGGAAGATGGGATTGGAGTCGTCGAGCGAGACTTCGACATTAAACTCGTCCCC
ACCACGTGTCCGCAGATCGCGCCGAGCGTCTCTCGCCTGGATAATAAAGCACGTAGGCTCGCCACTAGCTCCACCCGATAACACACCGGGGCCATACGCG
AAACAAAGGGGTGCATCGGTAACCGAAAAGTAGCTGTATGTTTGAAAAGTTGTCGTGAACGAGTCACCCTGAAGTGCTACACGGATCTGAATATCTCCAG
CAGGGTACGCAGTGAAGTCCGGCGTCACAACATTCAGTGTGTCATTCATATTCTCCAGGGACATCCACCGATCCTTTTCGACACGAGAATCGGATAGTCA
CTGCTTTATTGACAAAGTCGATGCCTTCGATCACCAAGGGAGTACCACCCGTAATCGGCCCAAAATCTGGATAAACCCCAGTGATACCATAGGGAGGTCC
GACAACGCAGCTTACGTCTAGATAGAACATATCGTTCAGCCAAACGTTGGCCCATCCACCGAAAACAATTAATCGACTGCCCTTATCATCATATGCTAAT
GTTGTATCGCTTCGCCCGCAGGGTGGCGTCCCCTCGATCTCTGGAATGGACCAGCTCATTTCACCCGTGTCAAGCACACTCAAATCGTTCATGTAGTTTC
CTTGGGCATTGTAGTTGTTTGCTTCACCCACTACGCCGCCAAACACGAAAACCTTTGCGTGTGGTATGGCGAGTACCGCACAACACGCGTGGTTCCACCT
TGGCAGCGTCGAGGCCATATGCGTGCCTTCCACAAGTGTCCACGAGTTCACGGCCGAGTCAAAAATGTGCAAGTCATTAAACTGTGCGACACTGTTCCAC
CCTCCACACACCAACATTAGGTCGTCCACAGCACAGGCCTGATGGCCTGCTCGTTTCTCCGGCGGTTTGCCCTTGCATGTGACTTTGGTCCAACTCAAAT
CATCTGTCCGTAGCATATACAAGTCGTCGAAATCTCTCCTGCTGTATCCTGTGCCTCCATAGCCTCCGAACACGTAAATAGAGCGTCGTATAGCAACTGC
AGAGTGGGCTCCTCTGGGAGCCGGCAGTGTCGGCGCCACAGTCTTGGCCACACTGGCACGATGCAGAGCATTGTTGTTATTACTATTAACGGCGGTCCCC
GGGGCTCCAGCTTGACTCCAGTCCAGCGTGATGGGGTTGAAGATCCACAGGTCGTTGAACCGCGCGGAGCTGCTGTGGAACCCGCCGAACACGTAAATCT
TGTTGTCCACGACTGTGGCCGAGTGTTTCCATCTGGGCGGGGCCACGCGCCGCCCAGAGGCGAGCGCAGACGCTCCCATTCGCTCGGAGCGTTGGCGTTT
ATCTTAAGTGCGAACAGGTCGTTCGTCGGCCCTGGAGGCTCGGAGTAGTCGCAGCCGCCGAACAGGTAGCCGCTGGAGCCCACGATGGACAGCGAGTGAC
CCGAACGCCTGGTCGGCGTCTCTCCGTTGCGCCTCG