Description :
From Genome Similarity Track
Location :
Scaffold_79:286487- 287857
Transcript NameFunction/comments
Physo_158054hypothetical protein

Sequence
1370 bases(100 bases per row)
TGCAACGAAGCACCTTCATGCCCACTTACTAACCTCGGTTGCTGTGCAATAGACAACTTCGGCTGTTCGTTCACGTGACGCCGTATCAATATGAGGCTAC
GACTCGGCCGTGGATAAAGACTGAAGTGAATGGCTTCGTGAACAAGATGGACCTACTTGGCGCTGATATCCAACTTATTATGTACGTATGACTAGCCGCA
TCGCTTTTTGGGGCGTACCTATGGACTAACTGGGCTTGCATTGGTTTGCATATTATTTTACTTAGCTATTTCGAGGGCGATGAGGGATCGTTAGCATCTC
ACTTCCACATTTTGCAAGATTTTGAGGCCAGTCGTTCGTTCAAAGCCAAAGGGGAAGGACTCACGAGCTCCCCAGAGCATGCCGTACAACCTGTTCGGAT
TCAGGTGTGCAAATAATGCAAGTCATTTATTCAAGACCTTCCACCCCTTGCTCTTGTTCTGCAGTGTATCATCGACAGCATTTGTCGACTGTCGCATTCG
CAGTCGTTGCCAGTTCAAGAGCAGCCAGTTTTCCCACCCCCATCCTGGACGAATGGCATGGCCTCTACCTTCTACCCCAGGGCGCAGCCTCTATCTCGGT
ATCCGATCTTCGGTAAACCAGCCGATACATATCCGCCACGCAAAACTACAAAATTCCTACTGGTATCTATCCTTCAATATTCCTCTCTCGCCCCTTCAAT
TGAAGAAATACATTGAACCGCACGAGATTGGGATATTCTTCACGACACCTGCTGTTGTTCGCGCTTCGAAATGACGGACGATCATTGCTTTCTGCTTGAC
GGACGGTACCTGTGTACTGTCAATCTGCATGTATTACGTGCACTTCTCAAGAAGATAGTGCCAACATCCTAGAAATTAGATTGTCGATTTGCAGTCTTCA
CACAGCGTCCCCCGCTTTCAAGATTTGCGATATTAATTAAAGGGGGCAAACACTATTGGCTCTCCGCGCCCCACTACATCAAAAAGTTCTTGGCTGGAGC
GTCATCCAGGCGCCTTCGACCATTCAACTCCTTGCAGACGATTTGCTTCAGGAATTCGGGGCCAATTTGATGATGTTCAGGACCTGAACATGAACATGTT
CAGCCGCACGCGACCGCGGAATTCTCCATGAGCAACACTAACAATTTGTCAATACACCACAACAACCATTCAACAACAATCCTAAAGCTCGCGTACGTGC
GGACTGTAAGTCTGCCAGCGTCGTGTTGCCCACAACGAGACGATTACCTTGACACAATCATCGGGCCATCAACATTCTCGTCAAAGGCTTCTTGGCCGCA
AATGTGTACATCTGAGGATGGGGTGCTTCCGGAACTTTGTTTACACTGTCGAACCACTTTGGTCGGCGCG