Description :
From Genome Similarity Track
Location :
Scaffold_65:286426- 287755
Sequence
1329 bases(100 bases per row)
AAGTTGGGCATCCTACGCCGCTTCGTGCGTCGCTCTATCCAACGTTGACGGCAATACACAAGCGGAAGCGACTCGCGTTTTCCCTCTGTCAAGTGCAGAG
ATCGCAGGTGAATCTGCCATTGACTAATTTTGTACTTGACTACATGACAGGATTCGCTAACGCGAACTGATCATTTTGGACAGGTCAAGGGCCTTGTTTT
CTAAATCAATGAATGATGTCGTTTATGTAGACGGGAAATGGTTCAGTCTTTACTAGAAATCGACGCGTTATTACCTTTCTGGCAATTAAGCTCTACCGTA
TCGCTCAACCTCGAAAAAGCGATATATCAGAAGGTGATGTAACCGCAGTCGCACAGCTATGGTACGACTTTCACAGGAAGGCCAAGTTCGATGGGAAGAT
CGGCATATGGCCTATTGTTGAGACCGTGTCAGCGAATAGTTCTTCCACTAACCGCCCCAATGGAACTTTGATATACAGAGAGTCACCATGACGCGTGAAG
TCTACGTTCGCATGCTCAAATAGAAAGTGTTCCCAGCAATCAGGAAGCTTTGGCCAGGTAACTATTATTCATGTTATTTTTCGATTAATGTTTTTTTGCG
TTGATTTGAAATAAATATTAGGTGGTTGATCGTAAACATCAAGGTTCGACAAGACAAAGCGGAGCCACACGTGTTGGTAAACAATGCTGACATACTGGAT
TCAGGGAGAGAAGAGAGTTGGAACACCATGATACAATGCTAGCCGTCGCGATCCCCAGACATGAATGTGTTGAGATAGGAGTGCTCAACGTTCTTCAGTC
AGTGCAGTAACAGACAGAAATACACACGACTAGAGCACTATAAATGCTGTAAACAGGGCATTCGAGCAAATTGAAGCGAACACAATCGACAAGACGTTCT
TGATGCTGCAAAAGAGGATGGAGAAGATGGTCGAGAACGAGGGTGGCAACAATTTTCAGCTGCTGCGTGATAAGACGATTTATTTTGCACGTGTAGCACA
TCCCTCGTCGTTGCCTATCGCTTCTGAGCTTGTTTGTAAAGGGTTATCTTCCTTGAAAAAGATCGCTAATCTTAATCTTAAAGCAAGAACAAAAATGATA
ATAAAATGAGTGTCGATTGGCTAATATTATTCCATATTCAACCATTTCTTCACACATTCCGCAAAATAATAATGTTATAAATCTATCTACATCAATTTTG
CATATCCAGTATTACAACTGTTAACCAGATTGTCACGCCGCTTTCTGGATGACTGAAACATCTTGTTTAAGTGAAATCCAACACCTGTTGACTTTACTGA
GTCAAAAAAATCTAAAATCTCTAGAAAAC