Description :
From Genome Similarity Track
Location :
Scaffold_610:2864- 4587
Transcript NameFunction/comments
Phyag_g6994hypothetical protein PHYSODRAFT_478586
Phyag_g6995conserved hypothetical protein

Sequence
1723 bases(100 bases per row)
CGTAAAGTCCAGCAACCGTCGAGCTACAGCAACTGAATCCGGGACAACGCACGTCTGCCAGCCACCCAACCGCTCTACACGGCCTCCTCTTACTTCCGAG
CACTCCGTCGTTTGTGCCTCCGTCACGTCCTGACTAGTAGCTGTATCGCCCGTTAGTCGACTGCTCAACAACTTAAACTGCTGCTCTGTAagctccgcca
gcgtctgcgtctcATCCGTTAGCGTGTTGTCCGTCCACACGATCATCTCGAGCTTCGGCAGCGTCAATAACCACGCCACTGGCAGTTTGTTGAATACACA
GCCCACGATCTGCAGCTGTGTGAGCGACTCCGGTAGCTTGGGCAGCGTGGCGTTGGTCAGGTCCAGGCCAATAAATAGCAGCAACGCCAGTCGTTCACCC
GTCCAGCGACTGACGGCGTCGAACTGTACGCGTGTCTTGCCTCCCTGCAGCTGTAAGGACTGTACTAGAGGTGGGAGCTCCACGGCCTTGAAGCTGTAGT
TTTGagcggcttgaagcgctACGCGCCACTCGCCTGTGGTCTCGGTGGAAGACAGCGCCATACATGCGTCGTCCTGCGAAGACACGAAACAAAACTGGGT
GTTGTGCGGACACTTTGCGGGGCAGCTGAGACTTGTAGTCCACTCGCGCGCGTAGGAAGACGagagcagcgtcgccattgcgAGGAGACTCGCccgcctc
cgtcgtctccgctgCATGCTGAAAGGAGACAATGGTTATGACGAGGCGGCTCAGGCCAGGCCAGACCTTGAGACCAGTTCCGGCTAGCGACATATGGCAG
AGCATGACAGCGACTAGCTTTTCTTTGTCAGGCGGAAGTAAGGCAGTATTTTACCTAAATACAGAATCTATCTAATATAGAAATACCTGTTGATACTTCA
GCTAATTTTTCCAATATTATCACGTTAGACAGATTAATATCATGCTGAAACCTCTTTATCACCAAGATACGACAGCGGTCGTAACTTGGTTCCGTCTCGA
TGAGAGCGAGCGCACCCACCCAACCTGCACCTGCCAGGCGACCTTGGTAGatcgaaagctgctgcatagCTGTGAGTCCATGGACTTGATGTAATGCATC
AAGTTGGGTCCGGAGGACACGCGAGTTGAATCCACGCCGCTGGAATGAATCGCGTCCTGGGAATATAGAGCTCGTCGCGACGGCGTGGTGATTGCGGTTC
CTCTTCAAAGATAGGTCCACCGTGCATTTCGGGTCGAACGAAGTGCTTCTGTGGTCCCAGCTGGGCAGGGCAAAAGAGCGACAAGAGTTAATCCGCTCCA
TCGTTGAGTCAAAGGCCGGCGCGAATTTGCTGCGAGGTCTCTACAGCTGCAAGTCATTATTACCTACCGAGAACTAATGGAGACTTGGCACGCCACAGTG
CCGCGTGCCGATGACTTCTTTGGCGCCAGAGAAATTGTAGCGTACACGTGTATTTCCTTGCGGTGCCTGGCTGTGGCTACTGAAAAGCttggcagctgca
gccacgttTGTGAAAGCAAAACCACATTTGTCCATATTATCGTTATTAGTGTGCAGCGCTGTGCTGTATGGAGGCGTCGTGGCTATATAACGGGTAGAAT
ATGCATTTTGAGGCGTTTGGGATGGTCTTAGAGCCCCAGGGGCTCGGCCTCgacttcctcctcgctcttgACGTCGCCCTTGGCCGGGAGCTGCGGCggg
tcgtggtcgtcgcaCTGTGTGAC