Description :
From Genome Similarity Track
Location :
Scaffold_662:2862- 4205
Transcript NameFunction/comments
Phymu_g11421hypothetical protein TRIADDRAFT_27830

Sequence
1343 bases(100 bases per row)
AGCATGTCGAACATCTACATCACTGAGCCTAACACGGAGggcaaggtgctgctgcacacaAGCTTTGGAGACctggacgtggagctgtggcCGCAGCAGG
CGCCCAAGGCGTGCCGTaacttcgtgcagctctgTCTGGAAGGGGTACGATTATCTGGCTTCATGTGTGGGATATGATTTTATGTTCTCATATGATATGA
TATACCAGTACTATGACCAAACAATTTTCCACCGCATCATAGCCGGTTTCATGGTGCAGGGTGGGGACCCCACGGGCACAGGCAACGGAGGAGAGAGCAT
CTACGGAGGTGCATTCATCGACGAGTTCCACTCGAGACTGAAATTTAATCATCGAGGACTTTTGGCCATGGCCAACGAGAACAAACCGAACACAAACCAC
TCGCAGTTTTTCTTCACTTTGGACGCCTGTGATTTCCTGAGCAAGAAACACACCATCTTTGGCAAGGTAAATAATATTGGTTCGATGTTGGATATGCACT
GCTTCTTAACTGTTTTATTTTATTTGGTTTTAGGTTACGGGTAACACGATTTTCAATTTGCTGAGTGTGGGGGACTTGGAGACTGACGCTCAGGACCGAC
CTGCCAATCCACCGAAGCTGTTGAGTGCCGAAGTGCTGTGGAATCCGTTTGAGGATATTGTGCCGAGGTAGGAGGGACACTGTTCACATTATTTTGAAAT
CGAATTTTAACACCCTTTATTCCAAATGAATAGGGCTGTCAAGAGACAAGATGTGCCGGAAGAGGAtgctaagaagaagaaacgtaAGGCTACAAAAGac
ttgaagttgctgtcgtttggagacgaagaagaggcctTTCAGGACGAGATTGGTGGTGAGGCGAAGAAAGctaaaaagaagaaagccaagacGATGATGA
GCAGCCACGATCTACTGAACGACCGCAAGCTCAAGTCGGAGGTGGATACAGAGGTGCTACAAaggatgacgaagacaagGGGCGAGGCGGCcagtgaaga
gaagaaagagcgATCACGAGCCAATCtgaaagcagcagtcgcggcTGCGAGTAAATCCACTCAGGCAGTAGCAGAAGCTTCGAACACGGGACCGAGTGCC
GTCAACGAGAACTTCGATACTACCTCAAGTCGTAAGAAAAAGGACCGTGAAGAGTACGCAAAACTACGTGAGGAGCTGCGGAAATCCAAAAAGGCCGTTC
CGCTGCTGATGGGCGAagaggcgaagaagctggagaaagacCGCGCTTTCCAGGATATGCTGactccactgcagcaacagcggcagaAGTATCTGCAGCG
AAAGAAGGCCAACAACCGCACTGCACGCGAGCAAGATACTCTG