Description :
From Genome Similarity Track
Location :
Scaffold_1613:2862- 4098
Sequence
1236 bases(100 bases per row)
GGACTTGCTGGTGGCGAAGGAGGCGGGCCGGCAACGATGATTGGGGAAGTCATCATCGGCGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGC
CAAGATTACTCCAGTTCCTGTTTGAATCTTCAACTTCTTCGTCATCGAGTATGCTTGAATGATCGGTGGGGGGCGGAACATCACCGCTACCACTGGGAGC
ATCAGGAGAGTCATCCACCGAAGATTCATTGTCATACACGTCATCTCCATAGTCGTCATCAGCATTCCCATCGTCATCAATCTCCATCAAAAGGCCAGGC
GAAGACACGCTTGGTACATCAGTCGTGGGAACAGTCGGAGCCGACTTCGAAGACGCGGAAGCTAGTGGAGCAGCCTCAACAGGGGCAGACCCTGCTGTAG
AAACCACTCCCGAGACTTCAACTGCCTTGGATGTCGCGGCAGACGCCGAAGCAGACTTGCCTTGTGGGACAGTCTGGTTTGACTCTTCATCTTCGTCACT
CGAGCCAAACATGAGCCGCATTTCCTCGGCTTCGCGCAGAGCCTCTTCAGCAGCACGTATGTCGGCTGGAGAAGGTGAAAATCGTTGAAAGCTGGTGACT
TGGCCACATCGTGTGGGCCCTGAGGCGGGGGCTAAAGGCGCGTCAGGAGAGACAGGAACATCGTCGTGATCCTCAGGGTTCACGTCCTTACCCCGAAAGG
CTCTGTAGCAGTTTCTTGAAACCGAAGAGACGCTGCCTGGGATCAGCAGTCCCCCATGTCCACGTCACTCTGGTCGCCGCTGAGGTCGACCACTGCGGGA
GTCAAGGAAGACGCTGGTGTAGGAGGTGGCGACCATCAGCTTGGAGAAGACGGTACAGACTTGGACCGAGTCTTCATATGACGTCGTGGCGACTTAGCAG
GAGAATGAGGACGGGGTTTCTTGCGCTTCTTCTGGGCCCCCTTCTTCCACGCCTTCGGACTGAACAGCGATCTACGAGCCGACTTGGGAGTTGAAGTATC
GGCAGGTGGCGCATCACCGAGACCGGCAGCTGCCATCGAAGCACTGGCCTTGTCCGTTGGGATTGGAGCCTTGTCTTCGTCAGAGTTGTCCGGATCGTCG
TCTGAATCCTCGCCACCTGGTCTTAGACGCTTATGGGACTTCCCATGGGCCACTTGGTGAGCTGCTTTGGCCAAAGCTGCCGGAAGGGCTTGAGGATTGT
CCGAAGACGCGGTGGCAGACTGAATACGCCGCAGAG