Description :
From Genome Similarity Track
Location :
scaffold_1442:2862- 3864
Transcript NameFunction/comments
g11371.t1 phospholipase D, Pi-PLD-like-1

Sequence
1002 bases(100 bases per row)
AAAGCTAGCTGTTTGCTATACCTGTGAACCCATCTGTCCGCATGTTTCACTATACGCGCACGCAAGATCTCATTTCCAGGCTGGTCATTCCAGCTTCCGC
CCAGTCGAGCTCAAGCCCCTTGTCCCTCCTCCTCTAAACGCCATGGACGGACTCAGTCGCGCCTTCCACTTCATCCTGGACCCGTTCCAGAGCGAGAAGA
AGCCCGAGAAGGCGGCCACCGCCCCCTTCGACCAGCCCTACCTCGAGCCGTCGCGCTGGTTCCTCACGGAGGAAGAGATGCGCACGTCTCGCGACGGCTA
CAAGCGCGACGGCATCCACCTCTACACCAAGGGCAACCGCGTCAAACTCTACGTGGCCTCCGCCCCATACTTCGCCGATGTGGCGGACGACATGCTGGAA
GTGCGTCGTGGGGACCTGGTCTACCTCACTGGCTGGGGAACCTGCAACGTCCCGTTCAAGCCCCACGAGCCCGACACGAAGCTGGCGGACCTGGCCGAGC
ACGCCGTGAAGCGCGGTGCCGACTGGCGCATGCTCGTGTGGTCCAACATCACGGAACGCGCCCAGAACCACGAGGTGCGCGACCTCATCAACGCTCTGCC
GCCTCCGGAGCAGCACGGACCTGCTCGCTTCGTGTACGACGACCGTCTGCCGCACGCCACGTCGTCGCACCACCAGAAGTCGGTGATTGTGCGTAAGGGC
CGCGATCTTGTGGCCTACGTCGGCGGTGTGGACCTCACCAACGACCGCTGGGACACCATCGAGCACGACCAGGCCGAACTCCGTGAACGCACGGGCATCA
AGGCCCTCTGGAACGGCTGGCTGGACGCCCACGCGCGAATTGAAGGCCCAGCTACCAAGGACGTGGCGCAGAACTTCTTCGACCGCTGGAACTCGGAGGA
CAAACCATCCCAGGACCTGATGGACGACCTGCTGGACTTTGAGAACCCGGACTACGCTCAACTGCCCCCTATTGACCAGAGTGAGATCCCTCTGGATATC
CC