Description :
From Genome Similarity Track
Location :
Scaffold_846:2861- 7692
Transcript NameFunction/comments
g14466.t1hypothetical protein

Sequence
4831 bases(100 bases per row)
GAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATA
CATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGG
GTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCAACATTAAAACAT
ATCGATATAAAATATAAGCCTTTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCA
ACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTT
TCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATACGAGCCCTCTCATTGGCTATTTAGTGGAGCCTCT
GCGCGATTGGCTATTATAATGCGTAGAGTGGACTACATCACATCGGAACTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAA
CGTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGC
AGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGG
GGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGAT
GCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTT
CTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCG
TTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGG
GGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTG
GTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGA
CGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCGCGAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTT
GCTGCTAAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCA
TTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAAAAAAAAGAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCG
CAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACG
CGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATCCTGCAGGTGTGT
CTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTAT
TGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTT
GTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCA
CCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAAC
TGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACAGTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGAC
TAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGAAGAAGT
AACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTAC
GAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCA
CAGGAGTGTACACGATCGCACTGAAGAGCGCAGGACAGACCGGGAGCAACACGCGGACCGCCGGGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGCGCGA
AGGGTAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTCACGCAGGAGGAGCGTGCCGAAGAACGGTTGGTAAACCAAGAGCAACATGCCCAGCGCC
GATCACAGCTCACACAGGAGGAGCGTGCTGAAGCGCAAAGGGTAAACCAAGAGCAACACGCGGAGCGCCGTTCTCAGCTTACACAGGAGGAGCGCGCTGA
AGAACGCATGGTAAACCAAGAGCAACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACACGCG
GAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCCGAAGATCGCATGGTAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGACCAGC
GTGCTGAAGAACGGATGGCAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCGAAGGGTAAACCAAGAGCA
ACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTG
GCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCG
CTTGGAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTA
CCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTC
AACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATC
CCGCCACCGGAGAGCGCACGGACCCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGA
CTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGA
GACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGC
TCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCC
GCTTCAGTACCTCTTCTGCTTCCATATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCC
TTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACG
CGCTAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTTAACGAA
GGTACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCC
ATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGT
TAGAGAATTCGGCAAGCCTGATGTGTTCATG