Description :
From Genome Similarity Track
Location :
Scaffold_2159:286- 4578
Transcript NameFunction/comments
Phypl_g14755putative polyprotein
Phypl_g14756putative polyprotein
Phypl_g14757hypothetical protein

Sequence
4292 bases(100 bases per row)
GATTCTGGCAGACCGTTGTGCCGGAATATCAGATCGAGGAACAGCCTGGCCGTGTCCTCTGCGGTAACTTGAGTGGCGCCTGGAGCAAGATGGACCATCT
TGCTGAAGCGGTCtacgaggagcaggacacCCGTGCGGCCCTGGTCGTCCGGAggcagctcgaagatgaagtccaTGCTGACAGAGCGCCACGCATCCGT
AGCGATCGGCAACGGATGCAGCGGAGCCTGCGACGAAGGCGTAGGCTTGACGCGTTGGCAAGTCTCGCAGGATCGACCCCACTTTCGGATCCACTTGTAC
ATGCGAGgccagaagaagtcgcgAGATAGCGCAGCGAACATCTTCTCGCGGCCGAGATGACCACCGACGGGGCGTCATGGTATTCGTGAACCAGACGGGC
ACGGAGGTCGTCATAGGCCGGAATGACGACGCGCGGCGAGTCAAAGGTGTCCATCGTGTACGTCAGGAGCGGACCGTCAAGCTGGTAACGCTTGATGCTN
GAACGACAGGCAGCGGGCCATGCGCTGCGAGAGATGCAGACTCTTGATCACAGTGCGCAGCGAAGCATGATCCGTGAAGCTGGCGAACAGCTGCTCCCCT
AGCAGATACACTCTGAATTTGATCAGGGCGTAGCGCATAGCGAGAAGCTCTTTGTCGTGGACTGGATAATTCTTCTCAACCGGCTTCATTTGTCGTGACT
GGTAGCTCACGACGCATTCGCGGCCCTCATCACCAAACTACACGAAAGCACACTCGATGGCGAAGTCACTCGCGTCGCAGACCACGTGAAACGACTTTGA
ATCGTTCGGAAGCATCAGGATCGGGGTATCCGACAAGTTCTTCTTCACAGAGTTGAAGGCTGACTGGTGCTCTGGACGCCACGACCACGTGGTGtctttc
ttcagcagcgacgacagcggctggATCAGTCCGGCGTAGTTCTTCGTATACTCGTGAATGTAATTCACCAGACCCAGCGTCTGGCGTAGCTCCATGGGAT
TCGTGGGCGTTGGCCAAGAACATATCGACGTGATCTTCTCTGGGTCGGCGCGGACGCCGTCTCTGCTTACATAGCACCCGAGTACTGGCATCTCGGGCGC
GCAAAAGACGCATTTCTTCAAGTTCGTGTACAGCTTGTTTTCGCGCATCACTAGGAAGACTTGTCTCAAGTGCCGTAGATGAACTTCGACTGCACTGAGT
GATCCTTCAGCGCGACTGTGGACGAAGATGTCATCGAAGTAGCTCGGTGCGAAGTCACGGAGCGGGCGAAGCACGTGAGATACCATACGGTTGAACGTCG
CGGGGGCATTCTTCAGGCCTTGCGGCATTACGAGCTACTCCCAGAGCATGCCGCTTGGGGTGCTGACCGCAGTGAAGGGTACATCNCTGTAGATCACGCT
GCCCGACATGGAGTCCAAGACCATGTCCTTCTGTGGGATCGGCGTCTGCGTAGGAATGGTGACATCGTTCATCTTATTGAAGGCATGAACGATGCGCCAT
CCGCCTGTGGCTTTCTTCACGCAGAAGGTCGGGCTCGAGTGCGGAGAGATGCTCTCACGTACGTGACCAGCCTTGCGTCGAccctcgaagaactcgtcaa
TTGCCTTGACTTGGTTTCGCGGCAGTGGCCACTGCCGTGTCACGCAGAACTTCGTACTAGGCGTGAGGTCAATCTCATGCCTCACACCACGATCGGCGGG
TTACTCGGCAGGAATCTTGTCCGGGGTGACGTCCACGTACTCGCGGGTGGTGTCATACACTAGGTTGCCGGACTCGCGAAGTGATTCCCACGACTGAGCC
GCGAAGTGCTCTTCGCGTGCCGACTTCGGCTCGTCACTGTTATGGCGAGCCGCCGCGTCTGCCTCGCTGACTGCGTTTATCTCATGAGTCGGTGAGCAGG
CGTCGGCGATCAAGCACACTTGCTCGATGTCACCTGCcttgaggtcgcgcaggaaatTCTTCCAGGAGAGTCCTGGCAGGCGCGTGATTGACGCGGCGTC
GCGAGGAGGACTCGCGACCTCGATGGTTCGGCTACGCTGCGGGACACCTTCCACAAACTCGAGTGAGTAGATGGACTTCAGCACTGCGGGTTCGTTCTCG
ATGGAGTCGCGACGTGGCTTCAGGTATCTACGCGACCGTCGAGATGTCTTCGTACGTCTCGAACCCCTGCTCGAGACCGATgcttcgctgtcgctggatG
ATGCTTCACCCTCCTCTAGGCGCGGGAGCTCGCTCTCGACCACGCCCGATTCAAGCGGGAGGAACTCctgctcgacagcttcatcactcTTGCGGGAGTC
GCCTTCGCTCGACCGGCTCGTTCTCATTCTCATCCAGCGACACGTCACATATCGTACAAAGGGGGCCATCGCTCACTCTTTGTAGGGCGTATGTCGTGGT
GGATTGGTCCACGACTCGGACATGCGGCCAGTCCTACGGTGCAATGAGTAGGTGGGTGAATACCgcgctgacgttgaagtcaCTTCGACGCTTGACCGAC
CGAGCCAACCAGTCGATCTGCGGCTGATACCNATGCAGTCGAAGGCGTAGTTCATCTCGTAGACCAGAAACTCATCATTGCTCTTGAAGCCATCGAACGT
GTACGGCAACGCGACGGCGCGTCACAGAACGCAGTATGGCTTTccgtcggccagcttgacgacGAGCACACCGGGGCCCTCGCGAACAGCGACCGTGGGT
GGAAGAAGAGACAAGCATGACGCGCGGAAGAAGCTGTTCGAAGCTCCAGAGTCCAAGAGCGCGCGGAGAGGACGCCGCGCGCCAGCGACGTAAAGACTGA
CGGTGATCAGCCTCGAGTCGCCGCTAGTGGTGGTGGCATTGAAGTGTGCATCCTGCACGGGGGGGGCTAGGAGATTCGGTTGCCACCGCGGGACCCGGAC
TTCCATTCCAGCCAGTAGGGCGCCCCACGCCTACTGGTCCGGTCGTTTTTTGGCTGGGCTGCCGGGGACGCAgcgtcgctcgtggagaCGATTGCGTTCG
CGAATACCGGCGCGGGCGCGTGGCACACCGCCGCACGATGACCTGGCTTGTCACAGCGGTAACAGTCCATCGAGCCATTACCACGACCGCTTCGATTGAA
TGGCCGGCCGCGGCCACCTGCCGCGTCGACGGTATCAATCTCCATGGGTTCCGGGGCATGACACACGAGCCTCAGGCGATAGTGCCCGAGGGTACGAAGG
CGCGACTGTATAGTCCTCGCGGAGCGCGAGGGCGAACGTTTCTTCCAGAGTCTTCGGCTCGGCGCGCGTGAGGCAATAGCGCGTCATTCCTTCGCACATt
ccgaagacgaagccatGGACCTGCGACGCCATGCCGATCGGACTCGTGATCGCGCATGAGACCAGGTGCCGCGTCTTCTGAACGTAGTCGCGCATCGTCA
TCTTGCCTTGCTTGAGAGCGAAGAAGTCGGCTCGCATGCGCGACTCGTCTTGGGGAGGCTCGAACGCGAGTCGGAGATCACTCTGGAGACTCTCCAGAGT
CGGGAACGCGTATTGATCGATGACAAGCTTGCCAAGGGCCCATTCCTTGGCCTTCCCAGACAGGCGGGACAAGAGGAAGTTGACTCTCGCCGTCGGTGCT
TCGATCAACCTCGAAGCGATCgcgatgtcgatctcgcggAACCAGCGGTTCAGTGAAAGACGATCTCGACCGCCGCCGGAATACGTCGacgtctccatct
tgaccGCATCGTGCCGCGAGGAATGCGAGGGGATTGGTACTTGCCGTTTAGCTTCGGCGAGCTCGCGTTCTATGAACTCTTGGCTTTGCGCTGTCGGTCG
GGAGTCGctgagctcagcagcgatgTGACGACGGCTTCTCCGGACACCGCCGCGAGGCGGTGAAGCGCTTGTCACTAGATAGTCGTGAGATGGGGGAACG
CCGTGTGGTCCAGGGGTcatcgctggagctccgGACGGCTGGTCTTCACTCATCTCGAACTTGGTCATTGGAAGGACTACAAAGTGCTACCAGATGTAAT
GGGGCTAGAAGTACCGTCATGGTCTTACACTGGAgttgcaagaggaagctcatAATAGCAAACCCAAGTGTATGGGATTTGGGGTAAATTTAACTCTGTT
TTCGTCTAGAAGGAAGGGTACCGGCGGTCAAGCCTAGTACAGGGGTGCCAAGGTAAAACCTCGGCGGGTAGTCAAATATACGTACGGACACTCGGGTCCC
ACAGATATATATAGAGCGACACCCTGTTGTCGCTCCTACCTCTCGGCCACACCCACTCTTGGATTGGCCAGAATAAACCCTCGGTTCAATGA