Description :
From Genome Similarity Track
Location :
Scaffold_98:285984- 287410
Transcript NameFunction/comments
Physo_141450hypothetical protein

Sequence
1426 bases(100 bases per row)
GGAAACAGTTGCAACGAAATTGAAAACCGAGCTAATGAAGCACTGGGTAGCCACTGCCAAAGTCCCGGACAAGGTCTTTCACATTATGAAGCTTGACAAG
GTAGAGACAGACATTCTCAGCAACCCCGAATTCATCAACTGGGCGCGGTACGTGGACGATTTCAATGCGAAGTACCACAAGCAGTCAACGTCGATGGTGC
CGACAGTCCTGAACTACTACAGTGACGACGTTATCTTCAAAATGACCGAGGCGGCGAAGAGTGTGGAAGAAACCAAAGCCATCGCCACCAAGCTGCAGGA
AGAACTGGTCCAAGCCTGGTTGAAAAGCAAGAAAACACCAGACGAGGCTCTGGTAGATTTCGGACTCGGAAAGAAAACCCGCTACTCCAAAAATCCGGTC
GAACCGCTGTTGGAGAGGGCGCTGTTCAACAGTTGGGTCAAGTACTTGGACGATTACAACGTGCTGTATCCCGAGAAGAAAACGACTGTAATCGAGGCAC
TGACGAGGAGATTTGGTGATGCAAATGTGGCCAAGATGATTACGAAGGCAAAGAAGGAGGTTGTTACGCGCAGCCTTGCCACAAAACTGGAGGCTGCACA
GCTTGAAATATGGTTGAGCAGCGGAAAATCCGTCGAAGACGTGTTCAACTTACTGAAGCTCGACTATGCTGGTGTATTCTTCTCAGAGCATCATCTCATC
AACACGTTGGTCTCGTACATGAATGTCTTCATCAAGGAGAACCCTAGCAAGGCCGCTACGGTATTCTCGACAGTAGAGACGCTCCTTGAGGGCAGACCCC
TAGGTCAAATCCTCATGTTAGCCGCGTAGTACCCCAGTATGGAAGGCGCTGCAACTCAAGTCCAGATGAAGCTGATCCTGAGCTACACGGCAAACAACGA
ATCTCCCAGGGAAATATTCAACATACTCGCCCTGGATGAGGTCGGAGATTCCATTCTGGCCAACCCGCTTTTCTCTCAATGGATGACGTATGTCGAGGCC
TACAACAAGAAGAATCCACAGCATCAAGAGTCATGGTTCCTACCGCTTCAAATTAAGTATGAATGGCATGGCGTCGAACGGATGATCGATGCGGCGATGA
AGAACCCAAGCACCGTGAAAATCGCCAAGCTGGTGGAGAGGGAGTGGATAAAGACATGGTTAGACGAGAAGAAGCTTCCCGAGCAAGCGTTTAAGTTCCT
TCGGCTCAACGACGCTGGTGAGAATGCGCTTTCCGATCCCAAGTTCAGAGTATGGGCCAAGTACCTGAGAGACTTTAACCATCGCTATCCCGAGGATAAA
ACGACGATGCTCGACGGAATCCGGGCGATCTACAAGGATATCGCTGTTGTGCCGATGCTTAATGCGGCGAAGGAGCAATCCGCCACGAAGAAACTGGCGA
CGAACTTGGAGAATGCACTAATCAGC