Description :
From Genome Similarity Track
Location :
Scaffold_70:28598- 32212
Transcript NameFunction/comments
Phyci_10181Hypothetical protein
Phyci_231978conserved hypothetical protein

Sequence
3614 bases(100 bases per row)
TGCTGCTGACCACCTTTTTTGAGGGCCTCTTTCCTTGCCTTCCACGTGCTTTCGCGCCCACCGCTACTCATAGCAAGCTCTAATTCCTGCTCCAGATCGT
TGTTGCGCGCGTCGAAGCGGTCCAACTCCGCAAGCGAAATCCATTCGAACAGCGGCACAATGCTCAGGGCAGTTGGAGCCAAAAGAGTGGACGCGACTTG
ACGTGCGAACCTCACGGCGCTCTGAGGAGTAGGGAAGCACTGGTAAACGTGCACTACTATCGATTCAATGCAGGTGGTGCCAGCAAACTGGAGCGAGACG
CTGACACACGCAAACCGCTGACCTGTAGCTTGAGGAAGGTCTGCAGCACTAAACTGGGCAGTAGCCCCAGCGTCAACGCTAGGAAAGTTTTCCAAAGCCA
TCGTCATTTCATCCTCCTTGTAGATAGCAAAGCGGCTGCAGTCATGGCCCTCTGACAGGCCCGCATTTTTCTCCACAGTGCAGATTTGTCGGAAGAGATT
GAGTGCATCGTCGATGTCCCGGAATTTGCCGAACACGCGAAAGCGCGTGAACTCCATGTGACCGGTAACACTTACAGCGGCAGCTGCTTTACGAAGTTGA
TCCGCAGCGGATTTGGTCGACTTTGACAGCTTGGCGGACGATAGAGACAAGGAGATCCCTCTGGACGGGGGTCGAAGGGTCTGCTCTTTCATGAATCCTA
ACACGGCGAAAGGCTGGCATACACCGTGAATAGGATCCCATATCGTGGCTGCGTTTGCGGTAACAGTGGTCGATGCTCCAGCTGGGCCATTCTTGAGGGC
ATTAAGGGAATTGTCTGTTTTCTCCGTTCGAATACGGCCACAACGACGCAGATCACTACGATATTGTTTCGCAGCCGACGTCTCCTCACTTTTTACTTCT
TTGATTGGAGATACCGCTGGAAACAACGAGCGAGAGCTCTTCCCGGTAACATTGGCGTCGCCTAGAACGTTTGACCGACGGTTTAGTGATTTACTACTGC
CCGAACCAGCGAGAGCAACGAGCGGCGCCTGTATAGTAGGCGCACAGTCATCCTGAGCTACAGGGGGCAATTTCGCCCGATGTCCATCTTGCTGGAGTTT
GAACGCAAGTACTGTAGTCGTCGATGACCTTCTCTGAAGCAACGAGGATCCAGGAGCAGATCGACTTACTTTGGCGTGCAAGTTCGACACATCCTTGCTG
TCTTGAGGGTGGGACGAGCTTCGACTTTTTGAAGTGCCTTCAGGTGAGGTGGCCCGATCATCATTTTCTTCACTTCCGGTTTCATTGTTCCGGTTGTTTA
GTTGAAGTTCGTTGCTGCAATTTACGTTAATCTGGCGCACTGCTCCCGATGCACCGAGTTTTGTTACCCCGCGACGGCGCTCAAGCATCAGAGAGCCAGG
GTCAATTAAGATGCGGGCTTCATTAAGTGGAAGCAGTGGCGCCGACTGTGATTTTCCTAGCGCAGCATTTTGGTGAATAGATATCGGACTCCTATCGGAA
CGCCCACCAACCAGCCCAAATGGCTGATGCTGATTTTCGGCCATGACGCTGGTGATGAATTCCTTCTTGTACTTTTCCCATGCTACCGATTTGAGAGCAC
GACTGGGTATGGATTCGCGAATGTATCCATTCGAGGATCGCTGCAGACTTGCCCGAGCTTCTGCTGACATCAGGTGGAATATATCAAACCGTGAAAGCAC
AAGAATTTTCATCGGGGACTCCGCTAAGATCGAGTATTCACGAACGAAGATATCGTTGAATTTCCCAGCGGATGCCCTGTAAACAAAAGCTTCATTAACT
ACTATGGCCGAATGGAGAAATGCCGATAACACTTACTCTGCACAGCCCAACACTGAATTTGGGCCATATCTTCCGAGCTCGTAGACCTGGCGCGCATTTG
TGATTGGGTGCTTGCCTTCATGAATGATTCGACACTCGCCCCGAGTCACGACGAATAGCTCACTTGCACGGGATCCCTAAGATATCTCATCGTCAGCAGG
AGACGAAAGTAAAAGCTGTAGGAGAACATACTTTTACACTCACCTGTTTGCAAATTTCACCTTTATAAGGAATGTACTTCTCGGTCATTACCGAACACAT
ACCTTCGATAGTGTTGTCATCCCATTCAGGTCCTATGAAGTAAGGATTCTTTCGTAGCATTTGCGCGTACTGCGCATGGTATTCGTTCTGGTATTTCTTG
ATCAATGGTTCGTATTCATCGCGACCTAGCACTAGCAGCTCACAGAACTCGGTGCACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAAGATGATGTAG
AAGTGCCTCCCGATTTGGCCTTCAGCAAAAAGCACGGTATTGGTGACAGCGCTAACGAGCCGCATAACCTTGCATAGCTGTTTCCGAACCTCAAAAGAGA
AACGTGAGAAAAACTTGACGCTCTTTAGGTACTCGACAGCGAATTTTAGGTCCTTTTCAGATCGCTGGGTGGAGCTTCGCATAAAAATATTGCGCACAAT
GTCTTTGTTGCTGCGAAATCGTTTTGTGATTTCGAGCGTATGAGTATTGCTCGAATCGTGCGACTCCTTGAGCAGCTCGCTGAACACGACGCGGTTGATG
AAAACTAGTTCCGCTGGGGCACCTGCAACAATCACAGAAGCTAGAGTACAATACAATGTGAATTTGAACTGGTATGTGACCGAAGCGCTGAAGGGACTAT
TTATTACCTGCGCGTACGTCCGTGTTGGAAAGCAAGGCCCGTTCACCGAAGGTATCTCCTGGACCCAAAAAGGTTAGGTGGATTGTTCCGTTGGTGCGAG
CTGGGTTGTCGATCTCGTTTTTCACCACCTCCACTGCATTCACACAAGTTCAGAAGGGAACACCCTTCCGTAGCCGAAAGATTTGTATGCATACCTCGAC
CGGAGTAAACGAGGTAGAAACTATCTCCGTCGTCACCCTGTACGAGCAATATCAAGCACAGCCCCTCGCGGTTGGTATGTTCTAGGGCGGCGGGAAAATG
TCCGCGACGACGTACCTCATGGAAGACGTACGTCCCTTTGTCAGCGTAGGCGACAATCTCGAGAGATTGGTATAGTCGATCAAGCTGCAGGACACATCCA
CCACGTCAGTCGAAGCTGTTCACCTAGGTCGCAACAGCGACGAACGAGCTCTACCTTAACTAGCGATGGGTCCAGCAGCAACAGAACATTGCAGCAACGT
CAAGACGAACGATGGATCCAACAGGAATCAGGCACACGTACAGGCATCGAGGTTGGAGAAGAAATCGAGCAGCTTGGACGACGCGAATAGCGATTTGAGC
TGGAGAAACACGACGTCAGCCGCGCGCCTGGCTCTCCACTCTCAAGGGTGCCCAGCAACGCACCACGTGGATGTCTTCGAGCGTCCGCTTGCCCGTCGGC
TTGCGCAGGATGGTGCGGCACACGTTTATCTGCGGGCTCTTGTGCTCGATGGCGCGTAGGAAGGCGCCGTCGCTGGCCATCTCCTCCATCTGCGAGGCCA
GCGACTTGCGCCTC