Description :
From Genome Similarity Track
Location :
contig_17:2859- 4710
Transcript NameFunction/comments
g4712.t1hypothetical protein

Sequence
1851 bases(100 bases per row)
GGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGGAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAAT
CCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAA
GCGACCAAGCCTTTTCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGT
GAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCATGGCAGAAC
GCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGT
GAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCGTTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGC
CAGACGTACACCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCACGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATC
GACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGGCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACGT
CGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCTAACGAGCTTCAGGCAGGCGGGGAAGCGCAAGAGCCGACCG
AGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTG
AAACCCGACGAAGAAGAAAAGTCTGTGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCA
GCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGAC
TGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGA
GAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGC
ATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCG
TGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGAC
CTTCGACGAGTTCATGTGCTCTATCGACTTCCAAGTGTCGGCCTTTGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTG
TACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGT
GCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGA