Description :
From Genome Similarity Track
Location :
contig_17:2859- 4709
Transcript NameFunction/comments
g3987.t1hypothetical protein

Sequence
1850 bases(100 bases per row)
GGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAAT
CCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAA
GCGACCAGCCTTTTCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTG
AGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCATGGCAGAACG
CGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTG
AAGAACCGCTGCCGTCACCCAAGGTGGAGCACAAGACTCCGTTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCA
GACGTACACCCTGACGCCGAAGGAAAAGGCGCGCGCAAGTGGGACCCCAAGGCTCACGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATC
GACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTTCGCGATGTCAACTTCGATGAGGCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACG
TCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCTAACGAGCTTCAGGCAGGCGGGGAAGCGCAAGAGCCGACC
GAGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCGCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGC
TGAAACCCGACGAAGAAGAAAAGTCTGTGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAG
CAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCG
ACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATC
GAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGC
GCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTG
CGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTTCGCGCGTGTGGAACGA
GACCTTCGACGAGTTCATGTGCTCTATCGACTTCCAAGTGTCGGCCTTTGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTG
GTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCA
AGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGC