Description :
From Genome Similarity Track
Location :
contig_17:2859- 4708
Transcript NameFunction/comments
g4960.t1hypothetical protein

Sequence
1849 bases(100 bases per row)
GGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGGAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAAT
CCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAA
GCGACCAAGCCTTTTCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGT
GAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCATGGCAGAAC
GCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGT
GAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGC
CAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCACGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATC
GACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGGCGGCCTTTGGACTTTCGACGCATACTTCGGATGAAGACGT
CGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACACCGATGGACCGCGCCTAACGAGCTTCAGGCAGGCGGGGAAGCGCAAGAGCCGACCG
AGTGGCGACGACGACACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTG
AAACCCGACGAAGAAGAAAAGTCTGTGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCA
GCCGATCTATCGGAACCGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTACACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATACGAC
TGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGA
GAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGC
ATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCG
TGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGAC
CTTCGACGAGTTCATGTGCTCTATCGACTTCCAAGTGTCGGCCTTTGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTG
TACGTGGACGACGTGCTGATTACCGGGAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGT
GCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGT