Description :
From Genome Similarity Track
Location :
Scaffold_5:285876- 287218
Transcript NameFunction/comments
Phyci_89679Hypothetical protein

Sequence
1342 bases(100 bases per row)
CGTCTTACAAACCAGGGTGCACGCCGAGGAAGCCCGGCGTCGGCTCGCCCTGCACCTCGCCGACGTACAGCGTGAACGTCTGCTTCCACTCCTCCACCGC
GGCACGGTCCGCCATGAACTTGGGGAACTCGTCCACGTTTGCCTTGCAGATCTCCCACGGGTGGCTGGAGCCGCTGTTGGGTGTCAGGTCCACGCGCACG
TTCTCGGCCACAACGGTCTTCTGCACCTCCTCCGAGATGGCCCAGTTCATGAAGAGCTTGGCGGCCGCCGGGTGCTTGGCCTTGTTCAAGATGGCGATGC
GCTGGCCCCACGCCAGGTACTCGTTGCCGCCATCCGTCACGAACGTCACGTTGGGGGTGCCCTCCGAGTAGgtgccgacgccaatgaccttgtccttggc
ggtgacgagatcgctggccgtgttggagccgcggcggaacgtgacgttctggttggccaggtcctcaacccagttccagccgtacttctcgacgtagcgc
gtgtacaggaagagcacggcgtcgtcgtcgttcgggtaggtggatgcgattttgcctgcccactgtgggtccacgaggtcggccggggatctgggcgctg
cgagtccgtccagcgccgtctcgtcgtacaggaagctgaaagtgaacatcatgtaagccatataggcgccgcgctggtcgcggaagccgtcgtagacctg
cgagaagttggccggcttgtactcgagcagcttgccctcctgcgcccaacgagggaagtcctgcagcgtctgcagcgcgacgaggtcgggcacgagcgtg
tcagtttccagctggttgtcgatgcgcacgtcgtggtacttgctgtagtcgacgaTGAGCGTGAAGTTGATCTCCGGGAAGGCCGTGGTGAAGGCCTCGT
GCAGCGAGTCCTGCTGCGACTTGAAGTCTCCGCCGTGGTACATGACGAGGTTGCCTCCTTCGGCGACAGCGTCGGCGTAGAGTTCATCGAGAGACTTGGT
TTCTTCCTGGACGGCGGCAACGCTGGACGCGAGAAGTGCACAACAGGCGGCGGCAAGGGGCGCGAAGAGCTTCATGGTGCGCTGTGCAGAGGTTTTCTTT
GCTGTGGTGGTGTTGCGGTTTGTAGCAAATTGAAGAGTGAGATGGTATCTCCGCGGTTCGCTGTGTGGATACTGTTCGGGCGCAGTTAGTCGTCGCTGTT
GGGGCCGCTTGTGTGGCTTTAAGCGCCGCTTGCTCGATCCCCGCGATGAGTGCGCTCTTGGCTGCAGCGTTTCTCTTTTCTTCAGTCGCGTGACGGGAAC
AGCGGGCTGGGGCTGATAACGTGGCACGGTGTTTGCGTCAGC