Description :
From Genome Similarity Track
Location :
Scaffold_8:2858- 4808
Transcript NameFunction/comments
Phyag_g248hypothetical protein

Sequence
1950 bases(100 bases per row)
AATGTGATTCGGTTTATCGCTGATGGCATGGGTGTAGCAGAGCGCGAGTGTTGTAATGGGAGTCGCGCTGCTACCGTCGCCATCTACAGCCGCATCACAA
TTTCACGGTTAGGAAATATGGGTGCTGCTAACACAGACGCAACTACATTGAAGGAGTTCCTACAATGGCTTTCACGTGCCGCAACTTCGTTGGGTCTGCC
AGGATATTTCTCGGCAATGAAAACGCGCTGGAGCAAACGCATCACAAGTTAGCGATGCATACCACAACGAAAACACGATTTTGAGCTGTCCATACCGCTG
ACTCGTATCCACTGCGCTTAGTACCCGCCCAACGTACGTGTACAGCTCCAGGCAATCCTCCCGGATATTCTGCGTTAGCACAGGATAGTATCAGAACTCC
ATTTCATATGCAACCCCAGATCATAGTCCGCCACACACATCCATTGTATCAGTAGTagtttgctgcaattgctgtaGCTTGCTGTTTGTCGCATTGAGCT
CTTCCGTCTTTCCTTTTAGGGAATGTTCGTACTGAGGACGCAGCAAAATAGTTAGCAAAATGATCCCGAGTAAAGCAGAATGTAATTTGACATATCTCCT
ACCTGTTGTCGGATGAGAGCAATCTCATTCTCTTTCGATTTCTGCAAGGCTGCCACCCGTTGACGTAATTTCTGGATAAAGAAAACATGACATATTAGCT
GTATGCTCAGATGCACAAAGCAACACAGTAATATTCCAcctgctcgaacagcttTTCACGATCTTTTGGGTTCTCGCCAGCTTCCACTTGAGAGTTAAAG
AGCGAAACGGACTGCTGCTGATAGGGGGCCTGACTACCCAAACTTGCCTGCATCAGGTTGTTGCGGCTTAGGAGGTTCTGCATTTCTGCTCGATGCCGGG
TGGCTTCCGATGCCAAAGCGCGCTCATACTCGCTCGATTTTTGATGTAAGCAACTTTCCAGCGTGGAAATTCTTCGCTTCTGCTCATTTATGACTCGCCG
CGCAGTCTCCTTATCCTTATTCGCTTCAGTCtagaaaaaaaaagcaaCAACGAGATGAGGTATAGCAAGTTCAAGCTCATTAGACGGAAACCTGCTAGGC
ACCCACCACGACTTCCGTGAAATTACTTTTTGCATTGGCATATTTTTGTCGTAAGCGGTCTCGGGCATTacgagcttcttcggctgctaTCGATGCAAAC
AAATGCGGTGAGCAGGGAATTCTGGGTACTTGCTGAACGACTTAGTCACGAACCATTCGCTCTTAGCAACCCTTGCGCATGCCCGGTAGACCCAGGATGT
TTACTTTTTAAAAATGTGCTAGAATCTGTAACACGATCCCCGTGATTGTGTTCGTCTGAAAACACGGACTTCAACACCAGACCATCCTACGGCGTAAAAC
ATACAGCATCAATTGATCATCAACTGGTATCCCGTTCGACGCAATTGTGAGATGTACCGCAAACTTGATTTCGCCATTATCCGAGATTTCTTCGGCCTGA
AAGCCGAGATCGTTCAGCGTGGCGACAAACCTGTGGTTGTATTCGGCACGTAAACCCTCCAACTGTCGGCGCAAGGTGCTCAGCTCTTCTTGAAGTTTCC
GAATGCGACGATCTTTATCTGCAACAGTACCGTTGATGTGGTTTACGCGGGGCTACCGTTTTAAATTTCCACGTTAGTGAAGGTTTGCAGCGCCAATATT
GGCATCGCTTACTTGATTCTGTACGGATCGACAGCGGTTGGCAAACTGTAGAGTTCCCAAGCATTCTTCGTAGTGCTCTTTCATCGGGTGAATCGTTGCA
ATGAGTGTGGTAAAACAATTGCCACCTGCACAATAATAAATAACGCAGAAACAGGGTTGGTCTACAAAGTCAATCATGATGGCACTTTTAGTCATGGCAA
GTCAAGTACGAACCAATACTATTCTGCAGGAGGCGTGTGAGCTTTGAGTC