Description :
From Genome Similarity Track
Location :
Scaffold_1:285798- 287191
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00060hypothetical protein
Phypa_INRA-310PPTG_00061hypothetical protein

Sequence
1393 bases(100 bases per row)
TGTACTTTCAATAATTTTAAAGGGGATGATAAACGTTTTATGTTTCTGGTAATGCATTTTCTTTTAATAGTTGTGCATTTCCTTGGTGCATGAACTTTAA
AATGAGACGGCGTCAAACGAACTGATCCTTACGAACCATTTGGAGTTATCGAGAAAAACGGCTTTAAAGATTGGCGAGTGAAATTCGGACTTAAATGAAG
TTTTGCAAAAAGAGGCTTTTCCCACACATACCCATTTTTTCTCGAGGTGTATCGAAAGCGATCTTGTACTCAACCGAACAATGGACATGAGTCCGGCCAC
CTCCTCCACTCCGGCACCACCCACCAGCAGTCATACAAGCCCTAGTGTGTCGTCCGAGCAGGGCGTTGCCCTTTCTGGTGAAAGAAGGCTGCTTGGGTTG
CTGAGACCGGATCCGGAAGGCCACAGTGACATAGAATTTCCTGCGCTCGACATCAAACATGACCGCCCAGGAGAAGAAGCAGAGAGTTCTGACTTCGTTG
GCGATGCTAATGAAGCAGTTCGGGGAATGGGGGAAAGACACGTTCTCGAGAACGACCTGGATGTACGTGAACCCCGCCCTTCGACGTTTCGAAAGCTCCT
GCAGCAGTATTGTCCGACTATTCGGATCAGGTCTCCTCGTAGCAACGTTTGTGACTTGTGTGCTATCCTGCACACACGCATGCGGTCGTGTATCACAGCA
GAGCTTACTGAGGAGCTAGACGTCCACACTGAAGCCGCGAAGAAGATGAGGTAGGGATGCAAGAATCATTTTGTTTGAGATGGGATGCAAAGATCATTTT
GTTTAACTGTGAACTTTTTTTTAGGCTGGAGTACAAGAAGGACCTGGCATCCGTGTCGGAGGATCACGCAGTGATCGTCATGGATTTCAGTCAAAACCTG
ACCCTTCCCAGCGTCGCCAGTACGCCGTCTCAGTGGTACTTCTTGTCTCTTGTGAACGTTCACGTCTTTGGAATCTACTACGCTAACAAGGGAATACAGT
ACAACTACGTCTACGAAGAATCGGTTGCTGGGAACGGACGAGGTCAACAGCATGCTGTATCACGTCATCCAGCGGATCGTGCTGACGAACGGCCATCGAA
AACTCGCTATCTACGCTGACAATTGCGGTGGCCAAAACAAGAATAACTTCGTTGTTAAGATGCTGCTGGCTTTAGCTCAAACTGGAGAACTTGATGTCGT
TGAGCTCAGGTTTTTCGTGACGGACCACACCAAGAACGCTGTTGACCGTGGCTTCGGCCTTATGAGGAAGAAGATTGCTAAGGAGGACGTGTGGACGGCT
GATTAGCTGCTCGAGGTTATCAACGACTCCTCGTCTAGCTCGGCCCTTGTCCATATTCCCAAAGAGAACACGATGATGAAGTTGTTCCGAACG