Description :
From Genome Similarity Track
Location :
Scaffold_264:28576- 30035
Transcript NameFunction/comments
Phymu_g7743chromatin structure-remodeling complex subunit snf21-like protein

Sequence
1459 bases(100 bases per row)
TATCAGCTGCGAGGATTGCAGTGGATGGTGTCTCTGTACGACAACCATCTCAACGGCATTTTGGCAGATGAAATGGGTCTGGGCAAGACTATCCAGTCTA
TCTCGTTGCTCACGTACGTGACGGAGGTGAAGCACAACCACGGTCCGTTCCTTGTGGTTGTGCCGCTGTCTACATTGTCGAATTGGGTGAATGAGTTCAA
GAAGTGGGCGCCTGATCTCGTGATTGTGGTGTACAAGGGGCCCCCTCAGGTgcgcaaggagctgcacaaACAGGAAATGGCGTCGTGCCAAttcaacgtg
ctgctgacgacTTATGAGTACATCATGAAGGACAAGCACGTGCTTCGTAAATACGATTGGCAGTACATCATTGTGGATGAAGGGCACCGAATGAAGAACG
CGCAGAGTAAGTTCGCTATGACACTCGGAAGCATGTACACGTCGCGCAACCGACTGTTGTTGACTGGTACCCCGCTGCAGAATAGCCTGCCAGAGCTATG
GGCACTTTTgaacttcttgctgccaaCGATTTTCGAGTCGGTGGATACATTTGAGCAGTGGTTCAGCAAACCTTTCGCCGCTTTCTCTGGGAACGGCGAC
ACGAACGAGTTATCAGACGAAGAGCGAATGCTTATTATCAACCGGCTGCATCAGGTGCTACGTCCGTTCCTTCTGCGACGTGTGAAGGCTTCTGTACTTG
ACCAGCTTCCGgacaaggtggagaaggtctTGAAGTGTGAACTCTCAGGGTGGCAGAAGATTATGTATCGACGTATCCAGGAAGGAGGTGCGCTTCtcat
ggagacgacggaTGGTGCAGGAAAGAAGAAGGGAAAGACAAAATACACGTCCAAGGGGCTGTCGAACGTTCTGATGCAGCTGCGTAAGGTGTGCAACCAC
CCATACCTCTTCCAGACCAACGGGTACCAGATTGACTTCGACATTGTGCGGTCATCAGGCAAGTTCGAGCTACTTGACCGCATGCTGCCGAAACTGAAAG
CTGCAGGTCACCGCGTATTAATGTTCAGTCAGATGACGCAGCTGAtgcacgtgctggaggacTATTTCAACTACCGCGGCTTCCGTTACCTTCGTCTCGA
TGGATCTACAAGTGCGGATGAGCGTGAACAGCGAATGTTCATGTTTAACGCACCGGActcgcccttcttcatctttctGTTGAGTACGCGTGCTGGTGGT
CTTGGCTTGAATCTTGCTACGGCCGACACTGTCATCATTTTCGACAGTGATTGGAATCCTGCCATGGATGCTCAAGCACAGGATCGAGCCCATCGTATCG
GCCAGAAGAATGAAGTGCGTGTCTTCAGGCTCGTCACAAACAGTCCAGTGGAAGAGAAGATTCTTTCGCGAGCAACCGACAAGATGAACATGAACAATCT
TGTCGTGGAAGCTGGCAAGTTCAACAACAAATcgaaggaggcggagcgGCGCGCGATGC