Description :
From Genome Similarity Track
Location :
Scaffold_1457:2857- 5050
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1457-snap-gene-0.5Leucine rich repeat containing 45

Sequence
2193 bases(100 bases per row)
CGAATTGGAGGGTGGTGTGGGTGAGCTGACTCGTGAGAGAGTGTACTTCGAGCTCATATTGGCGCTGCTGGGCTTTCATACAGCTCTGGTGCGAAGAGAT
CAGCTTGTCTTCCTTCTTCTCAAAATCTTTCTGTGCATCGAGCATCTGCTTCTGACACTTATCGACTTCGTCCTCTAACGCCCTGTACAATAAATAGTAA
GAGAGTAAGAACACGGATAGTGAGGGAACCTCGAAGAAAACAGGAAATCAATAACGCAGCTTAGCGTCATTCATTACCTGATACTCAGATTGAGCTTGTG
GATTTCGCTGTCTTGACTGTACTTTTGGTCCTCCAGTTGCGCGATGTGTTTGTTCTTCTGCTCCATGCTCTTGCTCTGTAACGACTCCAAGTGGCTCATC
TTCTCGCGCATGGCGCTGAGATCCCGCTCCAGTGCTGTCCTCGAAGAACGATACTCTTCAAATTCCATCTTGCGCTTGTTCTCCAGTTCGTCAAGCTGCA
TTTTGAGCTCATGGGTATCCCGCTTTGCGTCCAATTCACGCTGCTGAAACCGATTTCGCTCTTCTTTCAGCGCCTCTGCGTCTTTTCGAAGCATCTGAAT
GTGCATTTCGCTTTCCTCAATCTTTTCATTCTAGTCCACCAAATCATGTGGATATAGTTAGTGACAGGACGACATGTGGAGATTCAATCAAACATGATCT
AATTGACACTCACCAGCTTCTGAGCTTCTTTCCGAGCGAGCACCAACTCGGACTCGCAGTTTTCTTTCTCTGCGAGAACCTGCAAAAGCAATTGGTCGTC
GGCGTGCTTGGTTTCCTCAACCTCGAACTCTTCTCGTGCTGCTTCGTGCGGAATTTTAACTAGCGACGGTAGTGGTGGAGGAGGAGGCTGTTGTTCCTGG
AAAACGCGATTCCGAGCCAAGAGCTTCTCGATCTCTTCTGCATGTTTCAAGCTGCTATTGTTTCCCATCAACTCCAGCTTCAGCAGCGTATAGTTACCCT
GCAATGCCTCACGAAATGCCAGTACGCCAGCGTTCCCGATGTCGTTCCAGCGTAGATCCAGTTGCTTCAGCGTGCGGTTCCTCGTGAGTGCTTTCGCCAG
CGCCTTCGCCCCATCTGGTCCGACGTTGTTGTTGCGCAGATCCAGCGCCACGAGCCGCGTGTCGACCTCTAGAGCAAGCGCGAGCGATTCGACACCTTGG
TCGAGCAACCCGACGTTGTTCCACTCGAGACTGATCGACACAATGTTGTGCTGCGCGCGCAGCAGATCCGCGAGCATTTTCGCCCCCAGGGCTTCAAAGC
GATTGCCGCGAAGGTCAAGCACAGTCGGGAACGGCGCGTTGCGCGCATGCTCGACGATTTCCGCGCTCTTGTCGTCTCCATAATATGAGTTGCTGAAGTC
AAGCACGTTCTCTCTTGTGGTGGCGTCAACTCCTGCTTCTGCTGCAGGTGCTGGTCGAGGCTGCGGAGAGCTGAGAGAGAGATGATGTGCATCAATACCT
GCATTTCCGCCACCAGAGACGCCTGTCATCTTCGTGTCAAAAGAGATAGCGCTGGGATGCACATGAAGATGCGCACTGCTGGTCATTTTCGCGGTGATGT
GGAAGACGGGCTTGCTGGTACAAACGATGGGAAAATCTTGAAGGGTTGCAAAGATCGATGTGTGGCCCACTCCATATTTATGTCACTTCAATGTACCTAA
AATTGGCAAAAGGAGGGAAGGCTACCCTTTTTTGGCGAAATACTTTGCTACAAAAACCAAGTGTGTTTGGCGAAGAGCTGGTAATCCTGAAGGTGATCCA
TCCACATGCTGTAATGGTGCTCCCAAATAAATGCGGCGTGTGGTATCGTGTGTGGAACTCACTCAACAATACCAATATGTAGAATCAAATGGATCTGATC
CATACAAACTGTTTGAATCCACTTCGTATCTGTTCACGCTTCAAACTGCAGCAAACGCAGCTGGAGCTCCACTGAGATGCTTGCCCAACATGCAACTTGC
TAAACGCAGCTGTAATGGAGAGTTCACTGTGCGACACGAAACGAAAAGATCGTCGTTCGATCGCGTGAATCACACATTTTTCGCGAGTGGCACTCTGGAA
AGGAGGCGCTGAGTTGAGTTGAGCTGAGTTGGGCGGATCTCTATATTTCTGCAGCGACTGAGTTGTCTCCAGACCTTCCTTTTCAGACCTGCC