Description :
From Genome Similarity Track
Location :
Scaffold_161:2857- 4450
Sequence
1593 bases(100 bases per row)
AAGCCCAGCATCGCAGCCCCACCAATGACGCGGTGCTGTACTTTGTTGAAGTCGAGTCGGTTGAGGATCCATTCCAGCATTGCACGCAAGACGGGTTCTC
GTCGCGAGGGGGGCGGGCTAACGCGTCGCATGCCGGACAGAACCAAAGCGTGGTGGGCTTCAAGACTTGGTTCGAATCCAGCGAAGACCCGATGATACCA
GCGGACATGGCACAATTTAGACTGAATCGTTCCAGGCGACATACGTCCTTGTCCCGCGTGGCCTGCCCAGCAATGAACGGCGAAGAGAGCCAGGAGTAAC
GAGTGCGCGGTTCTGTCCTGGGGCGATAGCCATCGGTTGCGGCCAAGCCGTTGGCAGAAGGCGGCCCGTTGGCGCCAGGTGCCAGCATACTGGCGCCGCG
AGGATTCGGCGAGGGGATGCTGTTGAAGGGGGACCAACTCGGCAAGTCAACCTTCCGAATAACAGCTGGGACCGCTACCTGGGACCATCCACGAGTTAGT
TTGCGCCACCGGTGAGAATATCGGGCATCCCAAGTTCGTGAGCCCGCATCCGTCATGGTATTGTCCACTCCCGGTAAATGATGTGCTGACACACGGAGAT
TCCACTGGGCTTCGACCGCACCTAGCACCCGGTACAGTTCTTGGGCCATGCTGTCGCGACTGCTGAGGTTGTTGCACCAGGATACAGCGCAGCGATTGTC
GATCCAGAACTTGATGTGGGTCAGATCGTCTCCAGAGGTAGGGCGCATATCGTGGCCCCAGCACAGCACCGCCCACACGGCGCTCACCTTCTCCCGTACA
TTGATGGACAATAGGCCTTGGGCCATCAGCAGCTTCTCTGCCTCGTCAAATTGCACTTGAATGTAAAGCTTGCGGGCTGGATGAAGAGCACAGACACCGA
GGTCACTTGCGTCCATGAGGATGTTCACGTCCGCTCCGAGAAGTACCGCAGCGGCATTCCGCGAAGGCGGCCATGTCGCAGAATATGGTCGAACCACTCG
AGATCCAGGATGGCTGCAGCGCTCAGGCGAATTTTCCCCAACCTGGGCGTTTTGCGATGTAGGGCCGCTAGCCGCTGAAAGAATGGTTTTGCCGGACGGA
TGCACGAGCACACGTGCCACAGAAACCCAAATACCTCAGGTAGCTCCGTGCGTGTGACGAGTAGTTTGCGGCGCAGCGTCACGACACTACGGAGTGATTT
ATCGATCTTGTCCTCCGGAATCGAAACCGTGCGTCGCTCGGTGTCCCAGTCGAGGCCCAGCGCCCGGGATTGGGTCGACCAGCATGTAAACTTCTTCTCA
TTGACCGCTCGTGGCCCAAGCACCGCTAGCATCGCCAGCCGTAGCGCACACTCGCACAGTTCGAGGCGGTTAGCGACGTCTTCTTCAATCAGCATGTGAT
CATCGGCCCACTCAAAGCAGAAAAATGGAGACGCGTCGGGGTCAGTCGGACAGAGACTCGAGGGGCTTTCGCACCGGACGAGGAAGGAAATCGCCGAGCC
AAAAAACTGCGTAATGGGCTGGGGATCCGGTCCAGCCAAAGGGCAGCGCAAGATCGATCGCCACCGCGTTCTCCTCGGGTAAGACCCCTGCAA