Description :
From Genome Similarity Track
Location :
Scaffold_36:28557- 29976
Transcript NameFunction/comments
Sapdi_VS20SDRG_10505hypothetical protein
Sapdi_VS20SDRG_10506hypothetical protein

Sequence
1419 bases(100 bases per row)
TCCCCGTCGTCGTCCTCGGCGCGCTCGATGGAAAAGCGGAGCTTGGCGCGCGTCCACCAGTTCTCGTGCTCGTCGGCTTTCTCCTTGCGCTTGCGCTCCT
CCTGCATTGCCCACATACAGAGGCTGTCGATGATGGCTCTTCTTGACGCACCTCGCGCTGCTTGCGCTCGGCTTCGCGCTTTTGGCGAGCGCGCTCTTCC
GCAGCCTCTTGCTCAGGCGTGAGGTAGCCTGGCACCTAATGCGTCATGAGCAACGTGGTGCCATCCACGCGAAATGCGTACGTCGCACTCGTCGGGATCG
AACGTGCCATTCTTGATCTGGTCGACGGCGCGGGCCACCTACGCAGCAGGATTCGCAGGTGGCACGCAGCTTGGCCGTCACGCACCGCGTCGGCCTTGCG
CACAAAGTCGTCGAGGTCCTGGTTGGAGACGCCGCTGCGGCGCTCCATGTCGAGCAGGTCCATCGGGTTCATCATGCTGTCGAGCAACTCGGTATCTTGG
AAGATCTTCCAAGAACCGTTGCGACGCAAAATAGTGTACGACATGAATAGTATCGTGTACAGTATACACGTGTGTTGGCCTTTTGTGTGAAATAGAGTTA
ATCCGAGGCAGGCAAGCGCAGCATGGCCCACTACCTCAAGCTCTTCCTCAGCGACGTCAAGAACGCCGACCGGTGCCGATGGGACGATGGAAGCAAGAAG
TTTGTGATCGGTCGGCCGCCACAGCGCTTCAATCGCGTCCGCATCATGGGCGTCGTCATCGGCGTCGCGCAGCACATGGTCGAGATCGGTACGATGGCCA
TTGTCACCTCGCTTTGCGCATGCGCCATGCTTGTGCTCGTAGACGATGGCTCGGGCACGATCCTCGTTCAGTCGACTGTCGCCATGACGATCCGCCTCGG
CGACCTCGTACGTGCCACGCCATGATGTGGCGATGGCACCACGCAGCCACTTGTAGATCGATTGCCTCGGCGAGCTCCAGCCTTTGCACCCGCGACTCAA
GTGTCAATACGTCATTGGCAACCAGTACGACGGCGCATCCTTCGCGTGCCATCTCATCGTGCGCCATGTAGCATTTACCCAGTGCAGGACCGCAACATGG
AGACCTTGCGGTTCCTCGAAATCATTCAGCTGCACGTCCTTGCGCGAGCACCGCAAACCTCATCGAGCTCGCATTAGGTACAAGCAATGCTATTTTTCGG
ACTTGCCGGCGCCAACCGACGCGATGGACGGCGTCACGCCACTCCCGGCCGTCGTCAAGGCGACCATCAAGCGCAAGTTCACCACCGAGGGACTCAGCGA
TTCATTGACGGCGGCGGCGCCTCCCGCCGAGTACTTTCTAACCGTGCGCGAGGCCGAGTGCGACCGCTTCGCGAGGGGTTTGCGTCAGCTCGAGCTACGG
TGCGCCTTGCATATTGTAG