Description :
From Genome Similarity Track
Location :
Scaffold_26:285387- 287278
Transcript NameFunction/comments
Phyra_77744phospholipase D, Pi-PLD-like-3

Sequence
1891 bases(100 bases per row)
GATTGTGCTTGGCGGTGAGAGACAAGCATGCTGTGGCAATCAACACTTTCAAGCCAACCTGATTTTCACGCAGATGATCTTTTATTATGGCAGCCTTGGC
GATCAACTCCGACGCGATGGTAGTAATCCTCATTAGCCCGACCGGGTGGCCGGAAGTCTCCTTCATTTCGCATTCCGCCGCCTCTAACGCAACCGCGACA
GCAGCACCATGTCGTCCTCGCCTTTCACTGAGCTTACCGAAGGATTGAGCCGCGCCTTCGAGTTCATCGTCGACCCGTTCCACCTCAAGCAGAAAGCCGA
GAAAGATGCCACCGCGCCCTTCGACCAGCCCTACCTCGAGCCCACGCGCTGGTTTCTCACTGAAGGCGAAATGCTCACGTCCCGTGCTGGTCATCAGCGT
GACGGCATTCAGCTCTACTCGACCGGTAACCGCGTCAAGCTCTACGTCGCCTCTGCTGGTTACTTCAATGACGTGGCCAACGATATGATGGAGGTGCGCC
GCGGAGACCTCGTGTACCTCGCGGGCTGGGGCACATGCAACGTGCCGTTCAAGCCGCTCGAGCCTGATACCAAACTCTGCGACCTAGCGGAGGGTGCCGT
GAAGCGCGGCGCTGACTGGCGCATGCTCGTGTGGTCCAATCTCACGGAGCGTGCGCAGAACCACGAGGTGCGCGACCTCATCAACGCGCTGCCTCCACCC
GAACAGTACGGACCTGCGCGCTTCGTGTACGATGATCGCCTGCCGTTCCCCACATCGTCGCACCACCAGAAGTCGGTGATTGTCCGTAGAGGCCACGACC
TCGTGGCCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGGACACAGTCGAGCACGATCAGGCCGAGCTGCGTGAACGGACGGGCATCAAGTGTCT
GTGGAACGGCTGGTTGGACGCTCATGCTCGCGTTGTGGGTCCGGCCTCCAAGGACGTTGCGGCCAACTTTTTGGACCGGTGGAATGCCGATCCCAAGCCG
TCACAGGATCTAGTTGACGACGTGCTTGACTTCGAGAACCCAGACTACTCGAAATTGCCTCCTATCGATGAATCTGACGTTCCCTTGGAAATTCCCCAAG
ATGGAACGCACGCCGTACAGCTATGCCGCACCTTCAGCCCAGACTACGAACACTACGGCTTCGCGCCGCAGGGCGAGCAGTCCATCTTCCACGCACGCAT
CAAGGCGATCCGGAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTCGTGCCGGAGCTGCTGGAGGCCATCATGGACATGATGCCCAGC
ATTGAGCGCCTCATCGTGATCATGCAGCGCACTGTTGAAGCCGAGTACACGGGTTACGCCAAGTACCTGTACGACATGGTATCTCCCATCCAGGAAGCGT
ACCCGGACAAGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGTACATCCACAGCAAGCTGGTGATCGTGGACGACGTGTACGTGTCCCTGGGCTC
GGCCAACTGAAACCGCTGCAGCATGACGAGTGACACGGAGATCGGCATCAACATCGTGGACACGGAGCTGGTGCAGTCTCCCGACAACATCACGGTGAAC
AAGCTGGCGCGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAGCGCACGTACGACGAGCTGGACGCCATGACGTTCCTGGAGGCGTGCGACGCGC
TCGAGACGGCGGCCCACGACGACGGTAAAAGTATCATCGAGCCGTACGCCGTGGAATTTAAGCCGCAGTTCAACCTCGTGTCGGACGGACTGCGGCAACT
TGTCGACCCGGACGTGTTGGGCGATGAGAACCCGGCCAAAAAGTTCAAGAACTTCGTGGACAAGCTCGGCCCACAAAAATGTGAACCGTAG