Description :
From Genome Similarity Track
Location :
Scaffold_734:2853- 5707
Sequence
2854 bases(100 bases per row)
GAGTTGAACTCGTCCTTATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGG
ATCCATTCTATCCTTTGGTAAAGGGATTTCAAGATGTGATGTGTCACAACCCACCATCTGTCTTACCTCCCAAGAGAGGTGTACGTCATGAAATTGACCT
AGTTCCAGGAACTAAATGCTGCGTAACACGGCAGTGGCCTTTACCTAAGGAAAATTGTGACGTCATTGATGATTTCTTCGTGCTAAGCACGCGGCGGGAA
TGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGTCTAATGGTAAGTGGCGGATAGTGCACGCTTATACTAATCTTAATGC
TGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGCTGTTCTTCAGAACAATATGGTGGGATGTACATTGCACAGTGCGCTCGACTTAGTCGATGGT
TATTACCTGCTGCTCATGCGAGCAGGCGATATTCCGCTAACAGCGGTTAGTAGTACCCAGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGA
TGTCAAATGCCCCGGCTACTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATATTTGTCCATAGT
CGTACAACGAATGGTCGATCTGATGTGAATAATCACATTGATCATTTACGAGCGGTGCTCGAGTGCACGCGCACGAATAAATTGTATGCAAATGCATTTA
AGTGCATCTTTGGGGCAGAAGAGATTCCCTTTCTGGGATGCTTCATTGGGAAGCGATGCCTTCGAGCGGAACCCGTTAAGATAAGGGCCGTAGTAGATTG
GCCGGTTCCAAAGAACCAAAAAAAAGATCTACGTAAGTGTTTGGCCTTGCCAATTACTTGCATAAGTATAGTACGAATTACGCAGATATGGATCGGCCAT
TATCCAATCTTCTTAAGAAGGATGTGGATTGGTGTTGGGGTGACACCGAACATGATGCTTTTCAAGCAGTTAAGCAAAGTCTCCTTCATGCTCCAATACT
GGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGCGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAATAGATGTCGATGGACGCGAA
CGAGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAGCTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAATCAAAT
TCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACATTTCATGCATCGATGCGCACTGCGACACAGTCGTCGCATCTCTCTCAGAGAATGGC
TCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTACAAGCGCAAAATCCTTTGGCTGACGCGCTATCGCGCCGACCTGTCTATGAGCTTT
CTCACGTCACTACGCTGTCATCGTCAGTCACTGGCTTAATCCGTGCGGCTTATGCTAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTTGGATCGA
GGAGTTTACAGACTCGGACATAGAAATGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGATATCGCACAGATATT
GAGGATAACCCTCGTATCGCTTTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACGTGATACCACTTTAAGTGGTCATCTCGGTCGTG
AGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGATATCACCTATGTGCGTACGTGTGAAACGTATCAACGGGTGAA
ACTCTCAGCACATGCGGCAGCACCGCTGGCTAGTCTTCCTGTACCCACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGTCCTAGCGAAAGAA
TCGGAAAGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGTCTCATCTAGCGGCAGTGACGGAATCTATTGATGCCGAAGGTACAGCGA
AGCTGTTTATCGACCGTGTGTTTTGACAACATGGTTTGCCAGTGGCAATTGTCTCTGACAGAGATCCCCGCTTCACTGGGAAGTTTTGGAATTCCATCTT
CAAGGTGCTCAGTACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCTATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGCCATTTGCGCA
GTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTTTTCGCGCCTCTACAGGCTATACTCTGTT
CTACGTGAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGTTGGGGGAGAGGTTACCGATCGGATTGCTGATATC
AGCCCTGCTGCTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGTTTGAAAGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGTCAAGACCAAC
AAAAACAACAAGCAGATGCTAAAAACAGAGTTTGTATTGAGCGTTATAAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCCACAAATGTAGT
GTCCGCTGTCTTTAAGACAAAGTTGCGTCCACGCTTCATTGGACCATTTACGGTCACTGCCAAGAAGGGACGTGCGTATACGCTAAACCTTCCGCGCAAA
TTGTGCACACACCCAGTGTTCTACGTAGGCTTACTTAAGCCATACAGGAATCCT