Description :
From Genome Similarity Track
Location :
Scaffold_317:28523- 29822
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-snap-gene-0.16Mediator complex subunit 4

Sequence
1299 bases(100 bases per row)
CCTTAGTCGCTGTCCTCGTCACTGTCATCATCGTCGCTGTCGGAAAGACTGAGCGTGACTCGCTTCGGCACGTCCTTGTCCGAGTCGCTGTCGCTGCTGT
CGCTGTCGCTTGAGCTATCGTCTTCGTTCGTGTCTTCTCCGCCTTCCTCCAGGCGTCGCTTCTTGCGCAGGGCTTCCACATCGTCCACGACGTCGTCGTC
GTACATGGCTGCTCGCTTCTCCGGCAGTTTGAACTTCTTGCGGAGGATCTCCATCGCGTCGGATGGCAGCGGgTCGCCCGTCTTCCACGACTCGGGCAGC
GTCACGCCGTGCTCCTGCACCACGAACAACATGTCAGCCATCGCACTAGCAGACGTCGAGCATCTTCTAGCCATCCATCTACACATACCGCGAGCGTGCT
ACGCCCCATGTAGTGCAGCAACGCTTCCAGGGGCAGGTCCACGGGGTCTCCAGGCTTCCACCCAGGCGGCATTTGCTTGCGAATGCCCGCCTCGGTCGCC
CCCAGTCCGATGGGGATGCCATTGAGCTTGATACTAGATGCGTCTTCCTGTTCGTCTTTGCCCCcAcGCGCTGTCGACGACGAGTATGCGGCTCCTGCGC
GGCTGCcGGgCTCGTCTCCCTGCGTCACGATCTCGTCCACGACGCCACGGCTGAGGACACCAGCGCGCATCATGTGCTCCTGTGGCGCTGGCGGCATGAA
GCCAAACATGGGGAAGCCCGGGCGCCATTCCTTGGGGGCTGACGTCGTCCCGGCGATGCGGTGTGCGTACGCCACGACGTCGCGAGGGTCCAGCAACACC
TTGTGCTTGAGCTTGGCCTGcgccAGCACTCGGTCGTGCTTCTTGAGCACCCGCGCGATGTCTTCCTGCGAGCGCCGCAGCTGTGCCGCATAGCGCACGA
CCTTGTGCTTCTTCTGCGCCACTTGATGCTCAATAGCGAGGAGCTCCTTCTGCGCCACTTGGTGCCGCACCACTGCACTCCACACGGGTAAAGCGTCAGC
CACAGGCCCCcTGATCACACACGcGCCTAtcGTACATGTCTTGACGGCCGACACCAGCTCGCGGTCCTTCTCCAGCACCTTGTGGAACGTGTCGTTGACA
GTgCGCACGCGCGCGCcGgTGATGGTTGACGGTGGACTGCAGCACGTACCACACAAAACGTCAGTCGCTCTCTCTCGGTCATCCAGTGAGCAGATCAAGC
GCCTGCATACAGCGCCGCAGAGCTCAGCGACTCtAGCAGCTTGGTGACGAGGaagcgaTGCTCAtggaggaacacctccacgtcctcccgcacagacgg