Description :
From Genome Similarity Track
Location :
Scaffold_1911:2852- 4154
Transcript NameFunction/comments
Phypl_g14370hypothetical protein

Sequence
1302 bases(100 bases per row)
ACTTGCAACACGCGCGTGATCGCGATGACTTCCTTTTCAGCAATATGATATCTCAGCTCGGCGTCATTCAGAACGCGACCTGTATACCTCACTGGTTGGA
TGACTCCGTCATATTCCTGGCCTAGGACTACACAAGCGGCCCACTGGTTCGCATGTGGAATAATGGTGAACGGCTTCATCCGGTCCGGATGACGTAACAG
CGGCGTCAAAACGATCTTCCTCTTGAGTATCTCAAATGCTTCCGTGGCCTTAGTCAGATCACGTCTCGCGCGCACCTGATCGTCCGAAAGCTGATTTAGT
ACCGCAGCCACCACCGGAAAATCTTCAATGAACTTATAATAGTAGTTCAGACGTCCGAGGAAAGACTTGACACCTTTCAGAGTCTTCGGGAACGGCAGAT
CTTGAACTCTTTTCGCAATCTTCGGAACGGCTCGGATCCCCTCAGCACTAATCTCATGTGAGAGGTAAGGGATCGAGCGCTTTCCGAATTCGCTCTTCGG
AAGATTCACAGAGATGTTCCAATATCTGAGTCGGAACAGCAGTGCGTTCAGGGCATCACATAGTTGGTCCCAGGTCTCAGCTCCATGAGCGATGTCATCG
ATGTAGGAACTACGTCCCAAGACCGGAATGGAGTAGAGATGTTCCGTTTGAAGACAGTCATAAGGTCGGTCAGAGGTTGGACTTTCTGAGCAGCGATCTC
ACGTTCAGACTCCTCGCTCTCGGACGGATTCAAATCCAAGAAGTCTAGAACATCTTGGTCCacctccgcttcctccttGGGAGAAAGTCTCACAAAACCC
CACAGACAATTGTTGATAACAGCCTGATAGACGAGTGGTGCGTTCTTGAGTCCAAACGGCATGCGAACCCATTGAAAATGTCCAAACGGACATACGAACG
CCGAAATCAGCTTTGCTCGTTCTGACATCCGGACTGCCCAGAATCCACTGGCCATGTCGAGACTCATGAACCGCATCGCCCTTTCAAATCCGATCAACAG
GTCGTCGATCAGGGGTAGAGGATAGTTTGACAGTTCAACGAATCCGTTCACAATTCGGTAGTCGATACACATCCGAATATCCTtcccgttcttcttcaga
aCAATGACGATCGGAGATGCCCAAGACGATTCGGAGTGCTCAATGAGCCCTGTTTCCAAAAGCTTCTTCAAAAGTGCGTAGACTTTGATCGCTAAGTGAA
GGGCGATTGAACGAGGCCTCTGAGCAACCGGTTTGGCGTCTCCGACATCCAAGTCACAAATCACTCCAcgtgctggggctggagcAGCATTTCCGTCTCC
AA