Description :
From Genome Similarity Track
Location :
scaffold_1429:2852- 3946
Transcript NameFunction/comments
g11408.t1hypothetical protein

Sequence
1094 bases(100 bases per row)
TCTGACCTGATCACTGGAGCCAACGTCCTGGCGCTGATGGCACGACAACCGTGGCTTGTGTTACAGAACCGCCCGGAGCCTCTCACCTTCGATCGCGATC
TACATCGCCGTGCTGGAACTCCTTTGGGGCAGATCGCGGCAGCTTACGCGGGGCTCGAGTCCAATCACCTTCAAGCATACTGGGAGTCGACCCACTACCT
TGACATTACCCGCGCGATGCGGGCTGCCGATCCGGACCTCGATGGGTACCACCAGGCCCGCCGTCAACGGCGAATTCGAGTGGGGAATCGCTGGAGAAAG
CTCCTGGCCACGTTTCTCCCGATGATGCGGGGTCAGTGGGCTGATATCGACCTCTTGCTTGATCCGTTCTTCCTTCACCTGCCCACCACGCGAGATCGGG
TACATTGGTACCCAGGATCAGCCTCCCGAGTCGCCAACCGAGCCAATCCCACGTTGAACCGTCCAGAACCGACCGATCTGATCACGGCTTTGGCTGAATG
TGATGAAGAAGACCCCTGGCGAAATCAGTACCGCGATTGTCAAGCAGACCACCCTTCTCGACGGATCGGGCGACTTTCGGACAAGTTCAACCCCCCTGCA
GCGCCTTCAGCCCCGTGAGTTCGCGATCCAGCTTCGTCCGAGTCGTATCGTCCAAGATCCCAGCTGATAGCCCTCGATTTCTGCCTCACGACTCAAGATT
CACCGCCGTATCACAAGATCCGAGCTCTTAGTCCGATTCCCACTCTTTCTCCACTTAACTCAAAAATCTAGCCTGTGATCCACGTTCTTCTCGCTTTTTT
ATAGTTCTCGCATCGTGATCTCGCTTCATTTCAATTTAACCATTCGAAATCGCCTTTCACCGACCTCGATCACTCCTGTTTCACATGCATATACAAAATT
CAAAGTCCTCTTCTTGATCTGGATCACCTTCCAGATCATCCCTCCAGATCCCGGTGAGACGACCACGTCGACTCACTGATCGCCCTTCTACACCTCTTCA
TGCGACTGCATCACGCCGAACCGGTTGCAATTCACGTGATCTCGCAGGAACGCACTCAGTATGGCACCACAGTTGAGATCTGCCTCGTCGATCC