Description :
From Genome Similarity Track
Location :
Scaffold_18:28512- 29530
Transcript NameFunction/comments
Hyaar_Emoy2803165hypothetical protein

Sequence
1018 bases(100 bases per row)
TCGTTCACCACCAATTGTCGCGACAAGCATCCGAATCACTGACTGCGTACACTCTCGACGTAATCGCCTCCTCGTCACTTTGTGCACTTGTTTTGGACAA
AAAGAGCCGCAATGCTTGTTTCTGCGGGACTACATATAGCGCGCTGTCTTCAAAGAAAAGTGCATTCAGCACTCCCAGCGCCGTATCCCGCACACTCGCA
TCGCCTTCCATATGCAATAGTGCTAACACTTGGTGAACACAAGTGCCGTTATACACGACCAGCTTGCTTTTGCGCTCGACGTCGTCATTATGTAACACAG
TTTTCCCCAACCTCGTGAAAAGCGTCGTCAACATCTCGATGGAATCGTCATCCACGCTCTTAAACAGCGATGCCGTCACACCTCCTTCTTTCATAGCAAA
GCGATGTACGCTCTTATCCGGACACGCCGTCAGCGCCAGCACCAAGTTCACATAGACTGCTCGCAGCTGCACTGGAGCATGCTTCTCGATTGTTTTATCG
TGTCCGTCTTCCTCACTTTTCTTCCACCGTCTCGTCGCCAACTTAACAAACGCTGGACACTGGAAATTAAACACGCGCACGAATTCTCGCGCGGTGACAG
TGCTCACCTTTGTCACTGCCGTCATTAGCTCCAGTACTCGAAACTCAATCCACGGCTTGTCGCTCCAGCTCAAGAGCTTCTCCAACTGCACCATCTTCTC
CCGCACGACTCGGAGTGCAAAAGCTTCGGCTTGAGCGGCATCCAATTGCTGCTGAACTTGCAGTAAGTGCGTCACCACGTGCAAAAATATTGCAAAACTG
TCGCGCTTTTCATAGCGACTTCCCGCGCCGTGGTTCTCGGGCCACACTCGCAGGAAGAGCTCTCCTTGAGGATGAATAGCTAGAAACTGATGACTCAGCG
ACGATGCATCGTCTTGAGACAGCGGAATGGGCGGCGACGTGTTAGTAGCTGGAGGATACAGCAACAGAGAGCGGGCGAACGACAGAATCGCGTCGTCGAG
AGGCTGAGGGGTGCGCTC