Description :
From Genome Similarity Track
Location :
Scaffold_40:285110- 288775
Transcript NameFunction/comments
Phyca_LT1534508955Hypothetical protein
Phyca_LT1534571032pantothenate kinase, putative

Sequence
3665 bases(100 bases per row)
aacgaatcgaattcgtagcaaatcctatctgaccaagcgaaggttcctcgctacagtcttgttgtgggtatgcatctacgtcgaagatccttcgatgacc
agctggatactctgtgttgatgccatcaaccactggaagtacaaaatgtaaatggaagtgaatgggagaagcgtttacggcaggaagaaggcctcattga
tataggcaataaattattgtgcgtttatatgggggctcgcaggccagtaggtgtccgtaatcactcgctgcctacaagctttctctataggggtatgcta
tcgttcacatgacccgctggcgtttgagggggccgccgcacggaatcgaaggaattgcgcaccgctcggcctctgcggcctggtacttcgtccataagcg
cgtgagcatcgcctcctcttgtttccgacggatgtagctgctgttcgcgggaaggttggcgactactatccgctttggggcagcagtgggggcgcactca
gcgaatagactcgggtctagctcgttcaggtactcgtcaaggccccggataagcacgcgttcagtaggcttcggttgttgttgttgctgttcgagctggt
gctttcgctcgaggaactcctggatctcctcgtagtaactgcgggatcggctgtcgtggacgccaagaagctgactggaggcttcgtccagcccgccgac
ctgtgcacagatatacttctgcacatggtccatttcggcacgatattgctgctccttggcgggggacgcgaactgcagggggcgacgtacgatacgccgc
ggaacaggtgacggcttcaagcttctgctgggagacatggtgctggtctgcaaatagcggaatgtcaccaagctcccgcgccgaaagctcctgtcagccc
agaagtcctacgtctgttacctgcgatgcgatttgccccaatgacgactcgacaacggtcgtgacctaggtaccctagtggattcttttttggttaccta
cacctgggatatggaggtttctacacaaggtgtttgtatgcattgaagtgaagttttgtcaatgtgtttagacgggaaatgttgtttctcaagttttggg
atgcgtcatctggttctaaaaaaaacgaaaaaaagagacgaattttaactttccattcaaaaagttagcttcaactgaatttcgagtaaatcggtgacat
cttgttcgtgagacggcctgagctggattattatcgcgccaccgcaatggcaggattttggctcgttcgttgatgccacgcgggtggtcttgacaccaac
cgtgatcgtcgacgaacaacgcaacgagtgtgggttcaaccagtgtccatttaacgattgtagctccggcagatcggatctgggcgtggtgccaatgctg
tgcttctgcgtgtgacttgcgatatcagatggagttgccccgccttcgttgcaggcgattgagtcaatcattgacaggccccagttcaaagggcctcgct
cgtttttggcttgaatcatcggttgattcgtttgttgattcctggcaggagacgcgatggggagcttgacctttcagatccaggttcggagctcgtggct
ggcgttcaatcacagaccacacggagatagcctcgaataaatctactgtacaacatcacatagtactaactccacactctggtcagcagagttattactg
tattgcgtcattcatcttcctagttgagacctcactctactggtcaaaatcgttctcataatctccatccattggctaaaatgtttaaaagacgggagcg
gtccaagttcaatcatctcgcctacgtctacccatgacggcggacagcgcgctgctggctggtggcttcctgctcttctcctccacagtggcgctcttct
gtttagagcgtaaacgtcaccgccagcgcgtctggcgccagcgtctcacttacaagaagctctcgaaatcgtgcgcttggattttcccctctaattgcta
cagtcgctttctaaccgtcgaatctcctccttcagatccgatctgggcgaatccttcggcttggatatcggtgcggacgaaaatccattggtagcttttt
ctgatttaacgttgagttgacgctacgtggctgtaggcgggacactggccaagatcgtatactttgaacggcatgaagctggcaatgacacgcgcaagcg
tccacgctcggcgtccctggacgtggcggctggagaaatgaacaagttcttgcgcgagaaccactcgttcggtagtacgggcgtgcaggacgtgcggctg
aggatccacgccaaggctttaaacggggtgcgctgctttttagatatcgttttgtgtcattgctgggttaatgagagttcttttttgtctaggtcttcca
cttcgtgcggtttgagagcaacaaaactcgagatgctattgagtttattgccaacaatggcatcaatcagtcactcaggatcttgccctgcacgggagga
ggagctcacaaggtttgacgtgtggagggtttgtaatctgaattcatgctgacaaaataatggcgcttggtcacagtatggtcgtgcgtttactgagatc
gctgggattgagctggagaagtacgatgagatcgactgcactattctgggactgcatttgctgctcactacgctatccgatgaagtgtacacttttgagg
taactaagtgcatgctgcgttggtctgttgtatcatatcagttatgaacttttgtttctttgaatggctgcatactaggtcgtcgatttcaattcgttgg
cggcgtcacgggttaaaaccatccaaacagatacagatgaggacatctacccatatctggtgagtttgagtgtggtcagctttttaatggagtgactaac
tttaattatatgcgtggttgctctctgctatagcttgttagtattggctcgggtgtgagcgtactctacgtgaaggggccagggaattataagcgtgtga
gcggtagcagcattggtggaggcacctactgggggctatgccgtctgctgacacactgcgaatcttacgacgaggcattggacctgtgtgtgcatggatc
caacaaatcggtcgatatgagtgtgggagatatctatggaggagcgtacgataagtttaagctcccggcctcaactgttgccagcagctttggtaaaatg
atttctacttctcgtgagagtgtgagtgacgcggatctcgctcgatcacttttggtgatgatcacgcaaaacattggccaggttgctttcctcaacgcaa
ctctgtacaagaccaagaatatcttcttcgttgggaattttcttcggcacaacaagatttcgtcaaggactctggcgtatgcaattaacttctggtcgaa
tggagcgatggaggcacgcttttgtaagcacgaggggtatctcggcgcattaggtgcgttcttgcgccacgctaaggcaaccaatgcccacggagaagaa
tttgtttcagccacacgaggttcacggcagtcgtcttagatacaagggcggttttttgcaagagttttgtgaaaaccggaaagtttttttgaattagaaa
cattcgattgttcttggaagagtcatcgtcatgtgaagttgttggtaaaaagtttaaatgtcacc