Description :
From Genome Similarity Track
Location :
Scaffold_215:2851- 4356
Transcript NameFunction/comments
g4367.t1RAW37335.1 hypothetical protein PC110_g6416 [Phytophthora cactorum

Sequence
1505 bases(100 bases per row)
AACGTACCAGCGTGCCGATAGCCACCAGCGAGCGCAGGATCGTGTCGTCGCCCAACTCCTGGACTGTGTATGCGCCGTTGAGCAGGTCAGCAGCCAACGA
GACCACTACGACCTGGTCATCAGCCGTTAGCGAGCCAGGTGAGGCTGCCTGTACTCGCGCGAAGCTACACGAATGAATCAAACCCACGGTCAGATCATGT
ATATGTTGCCTGTCGCCACAGCACCGCAAAGTACCAATACTTACTTGAGAAGAACGGTCGAGAGGCTAAGTGCCACCAACTTGTGATGGAAGGCCTGGAA
CGACGGCAATTTGCCAAGCACCTCGGTCTTATGGGCCAGCATAGCCTTGCGTGGCGCGTCGTGCAGGAACATGTTAGCGAGCACGCGCAGCGATAGCATG
CGGGTTGCCACGGGAATTGCGTCGTCACCCTCCTTGGGGGCTGTCTGCAATCCCAAACTCAGCACCTTTGTAACGAGCGTGTCCAAACCAACTTCACCCA
GGGCACTCGGACCCTGCGGATGTACCACCACAAGCCGGAGGAGATCAAGCGTCGGGAAGGCGAATTTAGCGGGCCACTTATCAAGCACATCTCCCAATGC
AGTCATCTCGAGAGCAGCAAACGTGCTGGAGTGGTAAAAAGCCGTATCCTGCACTGTATGCACAATCTGCTCCAGGGCAATCAGCTGCGAGTCGATGAGA
GCAGTTGCCTCCTAAAAGAACACAATCAACGAATGTTAGATATTGCACTCATGATATCTGCTGAAATCGCGAACGTACCCCAGTCTCCTTCATCTTGTCG
TTGAACTGACGTAGCGTGCTCATGAGCTTCGAGATCTTAGTCGTTTCGAAGGTGTTGTACCCAGCCTAGTTTATGGACAGCGACAACAACGACATAATCT
TATGGTCAGACACGGACAGTTAGATCAGCGGTAATGATGTAAGAACGTACCACCGGAAAGTACTTGAACCGTGGCGCGATGGCAGCAGGCTCACTGGAAG
CAGTGCCACTTGGAGCCGAATTCACACTATCGGTATTTCCCAACACAGGTGGACGGTACTCACCAGCACGCTGCGTGATATAATCGGCGATTTCACGCAG
ATATGCCTGGTCCAACGTGTGCTTGTCGATAAATTCTTGTGCCACCGTGAATGGGTTTTGGCCCTGGTTGTAGCCGATCTCAAGCTTCTTCACACCGCCA
GGAAGTTCAATCTCGACTGGGATCACCATGTCATACGCTTCGCCATCGATCACACCGCCACCGCCAGTACCAGTAACTTCGCCAATCTACACCCACACAT
CCATAATGCACCTTATTAAAATATCAATTCACACCGCAGGAGTTCCACACGAAGCAACTCACGTCGATCCAAGTTCGCGAAGGTCCGCTCCACTGGCACG
CCCACGCCTTCGTACCGCGACGGAACATTTGAATCTGACCGTCCGAGTTTCCATTCACGCTAGCACGCTGGTCGTAGTCTGGAAGTGACTCGATCTCTAC
GCCAC