Description :
From Genome Similarity Track
Location :
Scaffold_828:2851- 4194
Transcript NameFunction/comments
Phypl_g11176hypothetical protein

Sequence
1343 bases(100 bases per row)
TTCATTCCCACGCGGCGAGGATCTCCTTGCGtgcctccaccagctcctcgttgtcGCGGTCCACCGCCTCGCACTTAATCCCCGGGAAGTTATTCTCCAT
GAGCGCCTGGAGCTGTGGCAGCTCCTCTTGAGGTGGAGCGTACGTGCCGCTGTTGTTGTCGAtgacgagcttgagcgcgtcgtcgtccgtcttTTCGATG
TGGAACTCGCCCGCGTACTTGACGGAGAAGGCAACGCCCGAGTGCAGCATGTGCTTGGACAACATGTCCTTGAAGAAGTCAGCACCCGTCTCGGAGAAGT
ACCAGCCCTTCGACGTGATCGCGTACGTGAAGAGCACGCGCTTGTCGTCGCGCTGGCCCTCATGGACCAGCTTGAAAAAGTCCGCAGGAGACGAAATGGA
GCCGTACTTGGTGCACTCCGAGCCGTGCTGGTAGATCACGGCGTGCTGCGTCATGATAGCTTGGCGAAGCACGGGCGACTCGGGGTAGTCCGGCGAGAAG
ATCCGCTGGATGGTCGGGTAGTTCTTGTTCCACTCGTTGTCAGCCGGCAGGAACTGCGGGATGTTGTGGAGCTGGACCCGGTAGGCCAAAGACTCGAGTC
TAGCATCGTTGGACGTCAGCATGGCCAAAAGCCCAGCTGACAAGCTTGAGTGCACCGAGTAGCGAACGGGGCCGGCTTCCTGCACGACTGCGAATTCATC
GGCTTCGACCTGGTGGCAGTTGACGTTGACGCTGATGGTGCCGGCCTTATGCTCTTGAAGTGTGATCGGCAGGTTGAACGCGGTCTCCGTGTCAAAAAGC
GTGTGGATAGTGTTGAACTGCGCTGCTcccagctcgtcgtcagcgtcgaTGTCCTTGTCGAACAACGTCAGCTTGAACGTCGAGTTCTGCTGGACGTTCT
TGAACAAGAACTTCTCGTTCCACGTGGGCTCGAGGGTATCGAAGATGGGGCGCGTCCAGGCCACTAGCTTGCCATCGATCTCGATCGTGACGTACGCGTC
GCTCGAAGACAGGCTGCCTTGGAGAGCCGCCCTCAGACCGAGGTAGTCACCGGCGGTGATCCCCTATAATACAAAAAGCATTGGTCGTGAGCAGGCGACG
CTCATCCACACAGCAGATCGAGGGACTTCATCTCACCTTCGCGGACACAATCTCGAGATCAACATCGACAAGAGTGCCGTCAGGCGCGCCCGGAGGGGGG
AACGAGACGGGCATGTAGGCAGTGGATCTCGGAGCGGTTGGTGATGCGAGCGCGTAAATCTAATAATGGCGCCTCTGCGCCACCATGCCGGGACGGCATG
ATATCCGCCACAAAATCTGGTCCAGTGTTTACAGACAGTCCAA