Description :
From Genome Similarity Track
Location :
Scaffold_15:285095- 294334
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08077serine protease family S08A
Phypa_INRA-310PPTG_0807812-oxophytodienoate reductase
Phypa_INRA-310PPTG_08079hypothetical protein
Phypa_INRA-310PPTG_08080mitochondrial Carrier (MC) family
Phypa_INRA-310PPTG_08081cytochrome oxidase assembly protein
Phypa_INRA-310PPTG_08082serine protease family S09X

Sequence
9239 bases(100 bases per row)
CATGTTTATGACATCGATTTCAGCAATAATCATCCGTGACCTTTGAATGTTTGTTCAGCTTTTCAAGTTGCGGAAGCTAGTCTTTTGCCGAGGGCCATTT
GACTAAAGTCACCAAGAGGACCGAAAAGTAAGGCGCAGCGGCCCGTGTGAACGTTATCATTGCGTATTTGTCAGAGTGTTTGATGCAAATATTTTGCATA
GGTCAGGGGATCGGATAGTTATCTATTGCAAGACCATGACCACTTGGCATTCCCACTAGTATTACTATTTAGCACCAAGCAGTTGCATAGCGCGATTGAC
ATCTAGCCGTCCGTAACCAAAAACGTTGTTCGGGGATGTGAAGCTCGAGATATTTCCACAAGATAAGTGAAAAGAAGCGCTGTCCACGAAACTTATATTC
TTCACCGCTGACGCCGTCAATGCGGCCCAAATCTGGTCATAAGTCAGTTCTGGTTGTGCGCTGAGCAGCAGTGCGACTGCTCCAGTAACGTGTGGTGATG
CCATACTCGTTCCAGACGCGATAGTGTAGACGTTGTCTCTTGTCCACCAAGCAGAGTAAATTCTAACTCCAGGTGCTACGATATCGGGTTTAATGCGTCC
ATCAGGTGAGGGTCCGGTGGAGCTTTGAGGAAGCAAAAAGTCGTTAGAGCTCGTCGCACCAACCCCAATGACGTTGCTATTGCCTCCAGGTGAGGCCACC
GTTCCGCATTTTTTGAAGGATCCTGAATTACCAATCGAGAAGACAGGGATAATCTCCGCTGCTTGCCAGGCTGCAATAACTGCACTAAAGTTTGCAGCTC
CCTGAACGACTCCCCAGCTATTGTTGACAACACGAGGGGCCTCGCTACACCGTGGGTTCTTGCCCTTTGAATCCGTTGGGCAAAGTACAAATTGCGCACA
AGATAATAGACTCGACTCAAGGCACGATGTTGTGCTTCTACAACCCCGACAAGCCATCCAGTTTGCTTTAGGGGCTACTCCAATGCCTTTAGACCCAACA
ATTGAGCCCACTACGTGAGTTCCGTGGCCAGATAGGTCCAACGGAGCCGCACTTTTGGTCTCCGGATCAAACCACCCGTAGTCGGCTCGAAAGTTGGATC
GCAGCGCCTCGTGCGATGCACGAACACCAGTGTCGATCGCCGCGATAGTGACGTTCGCTCCCACGATTCCCTTTGCCCACACTGCCTCTGCCCCAATCTT
CCCGACGCCCCATGCGTGGATCTTCGTCCCCGACTCAGCGTCGTCCGAATGTTCCACCTTGAAGTTATCCCCAATCGTTAAGATCTGCTCCTCATGAATT
TCCGCGATCGACGACTCCATTTCCAACTGCTGAAGCAGCTCCATCGTTGCATCTTCGACGTAGATTTGGTTAGAGATCCAGAACGTCGTTGGGGTTGAAC
GCGTTGTGGTTGTCTTGGTCTGGTCGTTAAGAAGGTTCAATACATACTGCTGTGCGGACGACGCTGACTCCTTGAGCGAGTCCACAAGTTGATGTATTCG
AGCTCCTCGTGATGCTGCACTGGACTCCAACGGAGGATTGAGAGCACTGGCTTCGTTTATCGCCGCGGCAGTTCCTTCGCGCATTGTCACGATCAAATTC
ATTTTGGTCTTGCTCTGGAATACGCGGTAGACGTCCGGGTGTACACGAGGGCCGGAATGAAGTGGAGCACCTTTCGACATGCCGACCGCGTTAAAGACAA
CTAACCACCACAAAGCACTGATAAATATTGTCATTGTTTGGGGACTGGACAAGCGGTTGGCCACGATAATCGAAAACTGTAGCGAGAAGAGGTAAGTTAC
TTGGTGGGTAGGATGTGTGCTGTTGCTAGTTCCTCCATGGCCAACCAATTTTGTCTGTGCACTGGTGGACAATCGGGCTAAGGACTGACGAGTAGCTTTG
TCAGCTCATAATGTAAGATGGCTACGTTTGTCTGACGCAACCACATTGATTAGGTCAGAAGCTCTGTCCGTCGTGGCGCCACCGATGAAAATCGCTAACA
GCTTTTTGTGCATCTCTTCATTGTATGCAGTTTATCTACTTGTAAACTGACGCAAACACTTTGCTTAGGTCAGGAATTCTTCTTTGTCATATCGATAGTC
GGCTGGGGGAGCATCTTCGACATGCCGGTGTGCACCGAATAGGATTACAGCAGAGTCGTTTTCGGATATTCACTTTGCAATTTCCTATCATCTCTCAACA
TCATTCTACCCAGCCATGTCCCCCAAGACAGACAGCTACACGCTCTTCACCCCACTGCGTCTCGGCAAAGGACTCGAGCTCAAGAACCGCATTGTGTACG
GACCTGTCACTCGTGCTCGCAGCGACATTGAAACCCATGCACCCGTGGAGCGCAATGCTATCTACTACGAGCAGCGTGCTGGGGCCGGACTCATCGTCAC
TGAAGCCTGCGCTATCTCCGAACAGGCATTCGGCTGGTACGGTTCCCCAGCGCTCTACACCGACGAGCAAGTGCGCGGATGGAAGGAGGTGGTTGAACGT
GTGCACAAGAAAGGAGGCAAAATCTTTGTGCAGCTTTGGCACATGGGTCGTCAATCTCACCCCTCGTTCCATGACAACAACGAAGTGGTGTCGTCCTCTG
CCACGTTGTACGAAACTGGCAGAACTCGCAACGTGAACGGAGAGCACGTGGGATACGAGCGAGCTCGAGCGTTGACTCTGAACGAGATCCCGGAGGTGGT
GGAACAGTGGCGTTCCTGTGCCGAGCGAGCCAAGGAGGCGGGCTTCGACGGTATTGAGGTGCATGCTGCGGGAGGCTATTTGATAGACCAGTTTCTTCAA
TCCTGCACCAACCAGCGCACGGACAGCTACGGTGGGTCATTCGAGAACCGCTACCGCTTCCTAGACGATGTTATTGAGGCGGTGAAGACAGTGTATCCGG
CGGATCGTATTGGTGTTCGCACTGCTCCTAACAGCCCGTACGGTGGAATGGGCAGCGAAAACAACGCCGAGATGTTCACGTACGTGTACGAACGCTTGTC
AGAACACGGATTGGCGTATTTGGCCATCCTTGACGGCTGGGAAGGAGTTGGAGTTGACGCACATTATCACGGTAAGTGCCGCCCGCTTACCACCTTCGAC
GCCAAGAAAGCTTTCAAAGGAACTGTCATTGCGAACAAAGGCTACTCGAGAGACACTGCTGAAGGTGTTCTTCGAAGCGGATCAGCTGATCTCGTTGGCT
TCGCGCGAATGTTCATGGCGAACCCAGACCTAGTCGACCGCTTCAAGAACGACTGGCCTCTGACCCCATTGATGGACTACGAGTTCTTCTGGGACCCTGT
TAAGGGCGACGAGGGATACATCACCCTGAGCAACTTCGTGCCCTAGGAGATAAGCACAGCTGTTGAATTGTTCAGCATTGTCCTTCAAATAGTTAATTTC
TTCATGTATCCATATATGGATAACTGTTTTAAATTTAACAATCTGAAGAAATTCTGAGCACTTGATCGCGTCTCTTCGATCAAGATATCTTTTTGATTGG
CATTATTGCGACCTGCCAGCAATAATGCAACATATTCGCTTGATTATTTTACTATTCGCTCTACTGCAGGTATCAACGGGATGAAATGGGTCACTTTCAG
CTCAAAGTCTCACGCAAAGTTTTTAACGTTGCTCTGTTTTCCGCAATAGCTGTCAAGAGCGGACGGTGTCGAAGATCTTAGTCATGCTCAAGATGAGGAA
GAATTGTCTTCGTGGGATAAAGCAGAAAGCGAAAACAAAATCGACATGAAACTCGAGGTGCGGGCTTCCACAGCGTTGCTTGGCATACAAGCTTAAGTTG
TGACGAAAGTGATTTCCACACAGGACGACGTCGAGCCCGAGCAGCTCACCGATCAAGATGAAGATCCACCGTATGAAAGAAAGCTATCACCCAGAGAGCG
ACTGGCTATGGAAGAAGAAGAGCGTTGGCAGGTGCGTGCTCGACTCATTTCGCCATTGTCCGCAGAGATTTGTACTAACATTTGGAGCAGCGGACGCTAG
AGGAAGTCGAGAAGCGAGAGCGTGAGGAAGCATTACAGACATCTGAGTCAACGCCAGAACTAGACATCAACGAGTCGGAATCGACCGAACATGACCAGGT
TCGAAGAGAGCCCCCTTGATGCGCTTGTCAATTGCGTGTTTACAGGATCGAATTGTCAATTTTTGCGCAGGGAACAACAGAAAACAACTATCCTCCAGAG
GAAGATGAGGCTTACGCTGCATACCTCGAACGACAGCGAAGACTGGTGCGTGCATGATGTTATCCCCTCGTATCTCTCAGCTCACTTAAAGTGAGCGTCT
AACTTATGCTGTCCTCAGAATGAGGAAGAGAGTGAAGCGGCCGAAGAGGACGAAGAAGTCCTACCGGTCATCCCAGGTCTGACAGACGTCGATTTGATTG
CGTTCAACGCCGAGTACGCGAACGAAGAGGTTCTTGACAAGATCATAGACTGGTCCTACGACCAGGTTGCAGATATGTCGCGGTACCGAGACAACTACAT
TCACGTGGAGGACTTGTACCAGTACGAGATCTTCTCAACTGCATTCGACTCACTTTGTACTAACGCGAATTTGCTGCAGGTTCCTGCTCAAGACGCTGAA
CCCGCTGGACGAGGAGATCGACGCGGACGACGAGCAGATCCTGACCGACGCGGTTACTGAGCTGCGCAGACAGCAAGGACTGGTGGACGACGAACAGATC
TTGTATCGAGGCTTCATCGCACGCGGCATGCCGCTGCGCTTCCTGCAATCCCTGGCTCAAGAGATGCACCAAACGGTGCAGACGAGGCGTCTGCAGGCTA
GCGCAGGTCGTGACGAGCTCTAGGCTAGAGTCTGCATCATGGTCAAGGCAACAAACAGCTTCAACTACCAACATTCCTTCGTTGTGAAATGATTGTATCG
AACCTTTGGATAATGATCTCTTGGATAGACCACCGGAAAGAATAAGCGACAAACTGCCGTTGATGTCGTTATGCGACGAATTCAGCCCTTAAAAAACGGA
CATCGTCCAGAATCTTCCAATCACCGTGTTTGGATCTGTCGTCGCTGTGATTGGTTCTGCGCGCGTGGCCGCTCTTTGATTGGCGCAATACCCACCCCAA
GCAACACAGACTCCTCCTCTACAGCCGCTCACTTGCCAAACTGCCTACGTATACTCAAGACAAGTCAAGAGGAATGGAGCTCAAGGCTGAGGACACGCTC
AAGAAGGCGGCGGCGGCGTCCTCGGGCGCGCTGCTCACGTCGCTGTTCGTCACGCCACTGGACGTGGCCAAGGTGCGCATCCAGTCGCAGATCCAAATGC
CGCCGTCCAAGACGCTGGCCGACCTGCGCGTCACGCACTCGAGCGTCGGTACGTCTGTGGCCACCGCCATCGAGCAGTGCCGCTGCCGCAGTCGATGCGT
GTGCAACCGCTCTATTACGCGTCCCGTGGAGAAGCTCCTGTCTTCACGACGCGGTTGCAATGCCCTCCCGGGTATGCGCATGTCCTGCTCTCGAGCCGTG
GCGCCTCCACAGCTTCAGGGCACGTCGCACGCGTTACGCCACATCTTTCAGACGGAAGGGGTCAGAGGACTGTTTGCGGGTTTGTCTCCCGCTATGGTTA
TTGCCGTGCCGTCTACTGTGCTGTACTACATGTCGTACGACGTCCTGCTACACGAGGGACGTCAAAGGTTCCCAGAAATGGAGGGATTGGTGCCGTTGAT
GGCTGGAACCACCGCACGGATCGTGGCGGCGTCTATTACGTCACCCATTGAGCTGATTCGGACGAGAATGCAGGGTGAGAAGCCAGGAGCCAGTATCTTA
AACACGTTCCAGCAGGCAGTGCGACGCGGAGGATACGCATCGTTGCTGAATGGACTGGGAGCCACGTTGGCAAGGGACGTGCCGTTCTCTGCTATCTACT
GGACGTCGTATGAGAATCTGCAAAGGAAACTGAATACGGAAGACCTGTCAAGAACGCAGAGAGCGTTCGCGTGTGGAGCTTTGTCAGGAGCTATTGCCGC
TACGGTCACGACTCCGTTTGATGTAGTGAAGACGCTACAGCAGGTGTCCATGACGGCCCAAGGATCGCAACCGTCAGGGATGGTGGTGCTTAGACAGGTG
GTGGCAAGCAAGGGTGTGGGTGGAGCCTTCACTGGACTCAGTGCACGTCTTGCGCGCGTGGCTCCATCCTGCGCTATCATGATCTCGTGCTACGAGCTCG
GAAAGGAGAAACTCGGTATTGAATGAGTGAAGATGCTAAGACGTCGTGTTGATGAAGATGGTCACTAATCCGGGCAGGGCAAAACAGGGCTAAATGACCA
AGACTGGTTTGATCGTGTAATTGGAGACGTAGGCCCGATATTTAAATAAATTGTTGCCTTGGAAACCCTTTCTCTATGTGCAGTCATCCTCCGTGGCTGA
TTCGCGCCATATTTGCTTTGCCATCGCGACACAAGGAATCCATTTTGGTGGTGAAACACTGGAAGCAACCCGATCGCTTGATCTTCTACTTTAGTACTCA
GTAGCTGGTGCGAAGTTCCATGAAGAAGGTATATAGCGTAGAGATTATGTACTAGTAGAAGTGCCTTGCATTAAATATTGTTGTTGTAACAATAGTATCG
GTCCAAACAAGCAATCTGCGTCCAGCAGCGCATGACAAAAGAATACGAGGCGAATCTGTCAGACAAAGGCAAGGCCTTAAGAATGTTAGTGCCCGCGAAT
TGTGCGTAACACAGTAGAGACTTAGTAACAAAGTATCGATTACCGCTCTACGCTCAGTGGAATTGTCGGTGCTTCTGAAAGCCTATGGATGAGCGAGAGC
AACATTTTGACCATGTCACTTCAAGTTCGCACTTACTAAAAACAAGTCAAACAATATAACTTGCTTTCGTTATGGGGTACGTTCTGGGGGTACACGCGCA
CTCTGGACTTCACATTGTGTACCCTGGGTACGCGCGAGCTGCATGACTTTGACACCGGTCACTTTCTGGTTGAAAATCACCCTTGTCAGATTAAGAAACG
CGACCAAGTTCCCGAGCGCGCTTGAGTGAGCCCAGAAGACGATGCTGGCAAACACAGCTCGACGCAGCGTCCAATTCGGCGCTACTCACAGCTTTGCCGC
CACTGTATGTTGCTCTGCTCGTTTTTGGCATTCCAAAAGCTCGAGAGTGTTGCTCTGCATCGTCGCACCACCCGAATACTGACCTTGCGACTGACTTTGA
CTTGCAGAGAGGCTTTGGCTTGGCCGGTAGCCGCTACCAGACAATGGTGAAGCCAGTGATGGCGGCTCCTTCCAAGACCACGTCGCTATGGTCACGTCTC
GGCCTTCAGGCGACCAAGACGACCAAGCTGCCCCTGGTCTACTCTACTAAAGCTCGGGTACGAAAAATTGCAATGACATTGGTTGCTGTGCAGATGCACT
TTGTAGTGCAGTGTGTTGACTATTGGTGACACTGCTTGGTGTGCAATTATACAGAAGTTCGCGGCCTCTACAGCCACACTTGAGAACGTAGCGGCCAACC
GCCCGATCGCATACTGGATCTTCGGCACGGCGGCCATGGTCGGCGGTATGATCGCCGTCGGTGGTGCTACTCGCCTTACTCGATCGGGTCTGTCAATGGT
GCAGTGGAAGCCACAGGGAAGTCTGCCGCCCATGACTCCAGAGGAGTGGGAAGCGCAGTTCGATATCTACAAGCAGTTTCCGGAATTCCAGCAGCGCAAG
AACATGGTACGGATTCGCTGACACCGTGGTGCATTGGTATTTAAAATGGTTGTTAACCCTGCGTTTTGTTTGATGTGGAGTAGACGGTGGAGGACTTTAA
GGGCATTTTCTGGTGGGAATATGGACACCGTATGCTTGGCCGCACGGTTGGTCTGGTGTACACAGCGCCGTTGGTTTATTTCATGCTGCGCAAGCGTCTA
CCTCGGGAGCTGTACACGCGCTTTGCCGTATTGTTCAGTCTGGGTGCAGCCCAGGGAGGTGTCGGCTGGTGGATGGTGCGCAGTGGTCTGGAAGAACACG
GCCACGAGCAATTGAAGAAGCGCAACGAAGTTCGTGTCAGTCCCTACCGTCTTGCTACGCACGTAAGTACAGTAAATTGATAGCGGCGATAGCAATTTCC
GATGAATTGACGACTGTTTGCTGCTGCTGACAGCTTGGATTTGCCTTCACGACGCTGGGTGTTCTTCTGTGGACGGGTTTCAACCTGGTTGCGCCTCCGT
CGCGCGCGGCGATGACACGTGAGATGATCTCGCCGGACGTACTGAAGCAGGTGACTCGTATCCGTAAGATTCTGGGCCACGTCTCCACTGCTCTCGGCTA
CACGATCCTCTCGGGTGCATTCGTGGCCGGTATTGACGCTGGTATGGCTTACAATACGTTCCCGAAGATGGACAACCAGTGGATCCCGGACGACTTGTTC
GTGATTGAGCCAAAGTACAAGAATTTCTTCGAGAACGTGCCACTCGTGCAGCTGGACCACCGTGTTCTAGCTCTCAGCACGCTCACGGGTTTCACTGGTG
TGTACGCCATGGCACGTCGCAAGCATATCTGGAACCAGCTGCCGCAGCAGTCGCGTAACGCACTGAACATGGCTCTGGGAGCTGCCAGTGGCCAGGTGCT
GCTGGGAATCACAACGCTGATCAACTGCGTGCCAATCCCGCTCGGCATCGCGCATCAATGCGGCGCCATCGCGCTCATGACGGCCACACTCTGGTCACAG
CACACACTCAACTTCGCCAAGCCGCTCAAGAAGGCCGCTCAGACTGCTATCAAGGCTGCACCAAAGACATTGTGAGCGGCAATTGTCTGTCGTTGTTGCA
TGTATCACAGGAGGCAACTTCCGCGAGCTAGAAAAAAAAATCACAAATAGAAAATTTGCAAAAAAAAGAAGAAAAATATAGGTAAAGAGAACATACGGAA
CAGCTCCCCTTCAAAACCGATCACCTTACCACCTGATAGTATCAGGCTGATACAGCACCCACCGTCACTAACGGAACGTCACCATGGACGACTCTGGTAC
GTCTGCTCTTCCTGCTCGTGTGATACCCGTATTCCCACTCGTGTATAGCTGACGATGTAGCCCTGTATCTCTTCTCTTTGCTCCAGCAACTGCGGGCGAT
CGTCGCGGCATGTGGGCCATGGTCAAGGAGGGATACGAAGGGCTTGTGAGCACCGTGATTCGCCCTCTTAGGGCGCAGTACACCCCCTCCGATCTCGGTC
CGAAGCGCGCACAGATCGGAGACGTGTCGGTGCAGCGCG