Description :
From Genome Similarity Track
Location :
Scaffold_209:28509- 36629
Transcript NameFunction/comments
Phymu_g6804hypothetical protein PHYSODRAFT_547717

Sequence
8120 bases(100 bases per row)
agTTGCGCCGAGAAGACGTACGTTGGCCCACGGAACTCCGTCTTGTAGCACGGACAGACGTACGATCCCTTGATGTCGAGCTTGTCGGCAGCCACAGCCT
TGCAATTGATGACAGGCATGGGGGAAAACATTTCCTTGGGATGGGACCTATCCACCGTGTTGTTCTGGATGTCCCAACGCGCGCCCATGAGGTAGAGGCC
GTGGATGTAAGCTCCGTCCCGAGATGGAGCGTCCACTTCTCCGTTGCGACGCTTAAGCACGTCCGTCTGGATCACCAGCTTGTCGAGTTCCCACTGGTTC
TTCTGGGCCGTAACCTGCATGATAGCCGTCAAGAACGACTGCGGATTGATCATACCCGACAGCCACGTTACACGTGGGATATCGGCCGGATTCTGCGTCC
attcctccagctgctgcagtcgagcTTCGAGGTTTGTGAGCCAAGATCCAAGCGGACGCATGGACGGGAAGGCCAACTTTTCCCACGACTTGGGCACTCG
GTCCAGGAACAAACTCTCCTGCACAGCCTCCATCGCGTCCGACATGGTCAACTCGCCTGCGAACCCCAGGGACAACTCGTTCAGCGACCGCACCACTTCG
GCCAACAATCCGTTCATGGCCTCGCACTCCTGGATAAACACGTTCTGGTACGGCCCCATCTCCTCCAAGTTACGTGCGATCTCATCGcactcgaacttct
tctcgcccACACGAGACAAAACCATTTCCAAGCCTTGTTTGGCCAACTCCAACGGACTCATGGCCGCGTCTcccgctgcagcatctcgaggctgcagctc
catcagaGTCCGGAAGAGATTCTCTGACTGAGTCGTACGGAAGTCAATCTCAGCGTTCGGGTGAAGGCCGAAAGCCAGAGGTGAGTCCGTCTTGAGCTCC
GTCTCAATGTGCTCCAAGTACTTGTCGTACGAGGACGGGGCGAGACACATGAAGGATGGACCCTTCTCGTCCCCCACGAACGGGAAcatctccatctcgt
ccagcagttcgtcaCGCATGTAGAAGTCCAGGTACGTGTTGGCAAGCAGCCGATCGAAGTCATTCACAATGTGGCCGCCGTACATGATCTCCCCGAAGAT
GTAGCGTAGATCTGCCCACGGGATCTTGCCGCCAGCAGAGCTTTCCAGATAATTCTGCAGACAAATGGCCGAGTCGCGCAAGTCACCGAGCGAGAAGGGG
TACATCATGTTGAACCCCAGAGGCCCGTACATCTTGCGCTCCATGAGAACAGCGTGGAAGTGGCACAGGCCGAAGAGGATGGACTTGACTTTcccttctg
cttcttcgatGTATTCCTTGGGGAAGCTCACAAATGCTCGCTTCAAGTTCGCCTTGAGCCCTGACGGAGGCTCGTTCGTCAGCTTAATGCAGCGGTTGAG
CACTCCGATGGGGATCGAGTTGGACGGATCCGACGTTAGGAACAAGCGGAAGTTCTTGTGCGAACCTTCGAGCGCAAATTCAtccagtttcttctccagc
actaGCAGCCAACGAGGCATCAAGTGGATGTTGTTGAGGATGACCCAGTGACCATTCCGGtgcgccacctccagacGATCCATAGCGAATACGTCCTGCC
CTTGGCCCATAGACACGTTGTGGTAGCTCACGCCTCGTTCGAAGCCGTACTTGACACTGAGTTTGTCCACACCCGCCACCACGTCCGCACCAGGAGACAG
GATGAAGTACAACGGAGTCGTAGGCGTGGAGTCCAGGTACGAGTTGTCCATGACCTGTAAAGCATTCAGAGCCGAGTCACAGTCGCAGTAGTTGCTGCCA
TTGGGCAGAACCTGGCGCACAAACTCGTTCACAGCCACCGTCATGCGGTCCGGACGCAGACAACGCACCACCAGAAGCTTCAGGAACGGAGTACGGTCCA
GTCCAGCCCAGTCtagcggcagcttctccgaCTCTGGGGTCACGTGGTTGTACCATTCTCGGAAGCGTGAAGACGCCTCCTTTAAGTCCTGCGGCAtctt
ctggaactcctcGAGCTGCGCTAACATGTTGATGGCGCTCCACTgagctggaggcagccaTTCAATAGGGTttgcttcctcttctcctccCCCTGCTACC
GCCTTCTTGGGTCCTCGCAACAGGAACTGCATGTAGGCTTCTTGCACTCGAACATCTTCACCCAAAATCCCACGACGCATGAGGTTAAATGTGAGCTGCG
AGAGGAAGATGAGCTTGTGCGCTTCAAACAACCCGCGAGAGACCCACGTGTAGATAGTGATCCGCAGAGATTCGCGTAGATTCAGCACTCGCTCGCTCTG
CTTGTCGCTCTGTACGGCTCGGTCGATGGAGTTGTAGAAGAACGTGATGAATGAGTCCAGGCTGTAACGGTACATGTGGTCGATAGCGCTCAATGTCGTA
AGTAAAAAGTAGAGCATGGCTCCTTCCGCCGCCACTGGACGATAGAGTTCTCGCGTGTTGTTGATGacgatctccgtctcctggttcttcttgactgAGA
TGGAGATATccgttgccttcttcttggtctcttccAGACTCTCGATCAACGGTACGTCGCTAAGGATATCGTCAGGCGCGTTGGCCAACCGCTCGAGAAG
TTggtcctccagctccactaGATCGATCTTGAACTTCTGGAAGGCCAgaaccagctcctgcttACGCGCTTCGAGTTCTGGCTGCTCCTTTTTAACCACT
TTCTCCAGTAACTGGTCTTCCAGGCCACTTTCAGTTGCGATGAAGTTAATCAACGTACATTGAGCAGCAATCTCCGGTTTGTAGTGAGGGTTGGACAGTT
TGGTCTGTAGGTACATGAAGAAATTCGGATCGTACTGCACTTCTTCGCCtgccaacttcaagaagaggtTAGAGCCTTTCTTGTAGACTGCACGGCCCAG
CACCGGGTCCAGTgtggcgtcgatctcctctCCGATGTTCTCAATGATAAGTACGTGACCATTCACGATCGCTGTCTCGGTCTTACGTAGCCACTGGTTC
TGACTCAGTTGGAGCACTACCAGCCCTcggtccttctccttctcgcgaaGCCACTTGATTCCTTGCAACTGCGGATCGATCACCAGTGGCCAGCGCTTAC
AGCTCGTGATAATAGCTCCATTCTCGATAGAGATCCGATCTGCTGGCAAACCTTCACTCATcatcttggcgttcttgccTTCAGTGGTCAGCATGGATAA
GGGATCGATACCGTCCGTGATGGGGATTCCCTTAGCCACGAGGTCTGGGAACCACGTTTGCTGCCACAATTCCTTGCGCACAGCCTGATCAAAAGCGCCA
ATGTACGagacgaaagctgcagccaagaggGAGTTCCCCACCACCATAACTCCAGAGTTCTTCAGTTGCTCGATCTCAATCCCCCAACGCTCGTTCTCAC
TGGCCAACCCGTTGACCAACTtgccagccagcagcagtctaTTCTCGCATgactccttcatctcctccaccttgagTTTCTCTTCTGTGGCTTGGCGTAG
AGTATTTTCTAAAGCTTCCAGTCGCTTTTGAACCTCAGCCACTTGGCCCATGGCTCTTGCCAGCTGCTCTTCGGcctcttctttcttcttcttggaaGCC
TCGAGCGAGTCCATGAGAGGCTTCACACGCACATAAATGCGGTTGAAAGTGTAGATATTCACGACCCATGAGCAGATAttagcagctgcagaactcTTGG
ACGCCATCTTTTCCGCTGTGAACTCGGGATCGGCAAGTAAAGGCTCAATACGAGCGATATCTGCTTCGGGGATGTCTTCGCCACGGAATTCCTTCAACGC
GTCCAAAAACGCACCCGCGTTGTTCATCATTTTCTTGGCGCGGTCCCATTTGTGGTTCTTgtactccttctccaccaagatCAGACACGCCTTTGTCACG
TTATCCACTCCCGCAGGCGGCTTTGGTAAACTCTTGAGCTCCGTAATGGCAGGTTTCGACAGACaatccacagcagcagcagcggcatccATAGCTGGTT
TAGCTTGACTCAATTCCTTTTCTGCTTCCGCTGCCagttcagctgcagcggcacTAGCAGCTTcggccttcgccttctccttaTTGGCGTtttcctgctg
cacctccgcTCCTGCCTTCTCCCGTCCCAtttgctccagtagctggTCAGTAGAAGCCTGCTTCTCGGCCACCTTGACCATTGTGTGCTTGAGATCTacc
tgcagctccgccacaTCAGCCGACGTCTTGCGTAACGTAGACAGACCGTCGTCCAAGCGAGAGATCTGGCGTTGAATGTCCTCTTTCCGCTGCTTGAGCA
GGATCTCGTAGAAGCTGAtgagctccaggaagctTTTGGGCGTCACGTAGTTGTACCTGCGTTGCGTCTCGAAGTATGTTTTACTCATTTCAGTCACGGA
AATGTGCACGTCGGCCATGTGATTCGCCAAATTGCGTTGTAAAGGAGCGTCTCCGATGtcctcgaacttctccaagAAACTGGAGGCCACACGCACTAGG
GCGTCACGCGGCCACGGGTGGAACCAGTCGATAACGGTGCAGTTTACGAGTCCGGGGAATCGACGAGCTCTTACTCTAAACACAGCGCCAACGGGAGAGA
AGCACATAACTACTCGGAAGTTGAGGCGAATCCGAAGCAACAGGAAGTCCATGAGTGCATCCATAGCATCCGGGATGCCGTTAGCCTTAGCTTCACTTCG
TAAAGCACCGAGAAGGCCGTCCAGGTCTTCTTTTGGGAAGAGATCAGGGATCCAGCCGGACGAGAGCATGTCGTTAATGTACACTAGGAATCTCTCGTTC
ACGATCTGGGAGTCTGTGATAAGGAAGACCAGTGGGAGACCTTGGACGCCTGCGATCTTGAACATTTCAGCCAGACTCTCTTTAAGATCTTCAATCCGGA
AGTTGGAAGTGACGGACAGTTGACGCACGTCGAAGCCGCAGATATGCGACGCCAGACGGGAAAGAGACTGTTTACCACTTCCTCCTACACCGATAAGCAT
TGCGTTGCCTCCAGGATTACCAATAATACGACAGATGCGCGTCACGTGCTCCATGGCGTTGtcaaacagctccaagttcatCATCGAGTACTTGGAGTTg
tagtcgtccagctgctccaccagcaccttgtttAGCGCCTTCATGGATGCCACAGGCATGTAAACGCTGTCTGCCCCAGCCACAGGCGTTGCGAAGGTCG
TGAAGATGTTCACAGGCACTGGTGCGGTCTCTTCTGAGcctggaggaggcggaggttGGTCGTTGAACAGCACCACCTGGTCCAAGTCcggcagcgtctt
cttggtcacTTCTCGGATCCGATCGCCGAACTTGAGGATGTCCTCGTCATTGATGAGGCGATCACAGAAGACTCGAGTAGATTCATGGACCCAGAGACGA
GCGAAGGAGAGAGCGGTGGGGAAGAACTCGCCCTTGGAGCGTGTGAGACCCTGGAAGATGTTTGAAAGCTCTCGCATGTTCCAGTTGTAGACGAACTTGG
TGGCGCTCGGGAGGAAGCGGTTTACCATCTCTTCATGCAGGAGGATCGATACGTTCACTATGTTCTCACATACTGCGACCACAGTGGAAGCAAAGCCTGC
ATTCTGCATGTGGCCCTTGAGGATGGAGTTGTAGATAGTTTTGAGGTCTTCCCGTCCTGGCATCATACAGGCAAACAACGCATAATGGCGCTGTAACCGC
TCGTCGATGATGAAGGAACCGGCTGTGGGGTTCATAGCTGACAGGTACTGGAcgtccacgatctccttccGGAAGCCCAAGTCCACGCGGTCGAAGAACG
TCTTGTAGTCCATGTGCTGCCGTAGTAGAGCCAGCGAGTTCTGTGTGCCGTATGTCTCGATGTAGGGCAGATTCAGGTCGTCAATGAAGTAGATGAGTCT
CTTGGTGGCTGGAGGGCCGAACATTCGCCCAGAGCGTTTATCAATCACAgattcgagctgctgttgaagcttgGCTGAGTCTGTGTAGTAGTTCATGTTG
ATGTTGGAGAAcagcatgtcgtcgtccagatcTCGCAAAAAGTTCTTCAAAATCGTCGTTTTTCCCGTTCCGCTGCCGCCTACCAGCATCGCTGGGCGCT
GTCGAGCAACCAGAGTCTCTACTAGGAAGCGGATGCGGACAGAGTCGTTCGTACTGATCACGATCGAGTTGAAAGGGGTGTCGGCTGGGCCATTTCCGAT
GGAACCGGGGATGTACTTAGGTACTTTGGTGCTCCAGCTCTCGAACTCTCCTGACTCTAAGTTGTAGAAGTAGTCGAAGCACTGTCCCTCCTTCGGGTAC
TTGACATTGGTGAACGTAGAGCACCAGAGCTCGTGGAAGTTCTTCCTGTAGTCGATACTCTTGTCCACAATCAGCGGGCCGCCGAAGGCCCACGTGgcgc
agaagacgaagatggaCTCAATGACCTCcggattcttcttctccactgggATGTTGCCTAATAGTCCTTCCAGTAAGTAGCAGATCGTCGACACCTGGTT
GATTAAACGTACAGGAGCCACTTGCTTGTATCCTTTTCGCATGAGATCGTAGATGGGATCCACGTACTTGTCAAAGAGACCAGGCAGATACGTacgctcc
acttcctcttcacgtTTAGCCACCCAAGATTCCATGAATGGCCTCCAACCGATATCAATCTCGTTAATAAACAGGATACCAGCTCGAGAGACGGTCGCAG
GGGTGGCGTTCTTAAGCGAATTGATCTCAAAGACCATCCGCATCGCACTACTGAGCGGGATACGCTCGTTCGAGACCAAAGTCAGCACCTTATTGTCGTC
CATCACAGTGTTCATGGACTCGATCCACACGGCATCGATATCTCCATCCAGTACCACCCACTTGTACGTCTGGCTCTCGTAAAACCCTTGCTCCGAGTAG
TTTTTCGCCATACCACGCATGATAATCGACAATACACCGTCTTTCCAGTCCTTCGACAGCGTCATGTATCCATAGAGTTCATCAGAAGTCACGGCCTTGG
GGTTGAGCGTCTCGTACAcgcagatcttcttctccttgcctagattccagcacttggccagcgcctgccacgtcgtcgtcttggcaCAGCCTGCAGGCCC
TAGAAGCATCACAGAGTGGCGCACATCGATGAGTTCCTGCAACTGACAGATCTTCAGGATGAACGAGTCGTCGTGCTGCAAGTTGTTGGCCTTACACACC
GTCACAGCCTTTTCTCTCAGCTCAATATTCACTTTAGGAGCCACTTCCACGCCGATGAACAGGTCGTTGATAAGACGCAGGAAGATTGGCGTGTCGTGAT
GCGGGATCTTTGGAGTGTTGAAGTCTCGTAGAGCTCGCATGAGAACTTTATCCTCTTCGACGTCAGGCTCCGCTCGCTTCAAGATTCCAGCCACTCGAAG
CACGGACTTAACTGCACGAAGGCCCCAGTCGTAGTGAAACTGCTTGGACAACAGCTCCCCACTTAGTTCATACAGCGTCACGAACTTAATCGCCAGAGTC
CGAGCCTGTTGGAAGCCTTCGGACATGAGCATATTCTCGCAAATAGGCTTCAAATCCGGTCGGATCATAGCACACGACCGGAAGAGCACTTTGAGGTTCT
CTGGTAGCTCCGTGCGCCCAGCGTAACCAGGATTCATCGTGATGAAGAAACCACACGTCGGGATGAGCGTAATGCGATCGGAGGCGCCCATGAACTCGAA
CTCTCCCACAACGACGGGGGGAGTTCCTGCCGGTAGAGACTGGTACTTGGCCTCTCGGTTCGTAGGAACAGCGTTGAACACAATAGCGTCTTGAATGCAT
TTAACTTGAGTAGCCACCACACTCAAGACTTCGATGTTAATGCGATTGAACTCGTCAAAGCAGCCCCAAGTGCCAGTCTGGCAAAGGCCTCGGAAGATAT
CGGCCATTGTCTGGTAGTTCATCTGGTCCGAGCAGTTGAACACGTAACAGCACAGCGCCATAGCTCGAGCCAGATCCTTCGTGGTTTCTGTCTTTCCCGT
ACCTGCAGGGCCAGCAGGGGCTCCTCCTAAGAACAACCTCAATGCCATTGTTAAAGTAATGTAGCAGCGATCTGTAAGAGGAGTAATGACCAGTCGACCA
GTGTTGCCGATCCATTCGTA