Description :
From Genome Similarity Track
Location :
Scaffold_25:28502- 29845
Sequence
1343 bases(100 bases per row)
GATAGTACGGCCTAAGGTGACCGACGTAGAATGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTATATGCGTGCCTAGGCGGCACAGCACACGA
AATGGACCGATGAAATTGGGTGGTAACTTTTACTACCCACGTTAGTAACTATGTGTAAAGGTAAGTTTACCGTAGACAGTAGGACCAAGTCGCCTCTATT
GAATAATCGAACATTTTCCCTTCCATTCTTGTCAGCGTTTCTCTTTTTTCGGTTCACCGCCTCTGTGATGGAGTCTTGTACGAAACGGACAGCCGTTTCG
CGAGCCAGTATGAATTCATCTGCTGAATCGCTGTCATTGGCTGCAGTGCTCTTGGAGCGTACTGTAGCAAGATCACTTGTCGCCTTTGTGAGTGTGACTT
TGGACGCACTAGGCGTGATGCTGATTTGATCAGTATCGTGGTCAGTAAGTGCATCTTCGCTCTTACTTTCCTCTTCTTCACCAAAATCAATGTGATCGAC
ATCGGCGTCGAACGTAGTGACTACATTTTCAACACGTGACGAGTGAGAGCCGGATTGGCGTTCGCTCGAATGAGCCCCCCCCCCTTAAACTAGAGTCACA
CTCTAAAAAGGTGGGAAGACGCGGATGGCGCAAGCCATTCACGAAGAATGGCGTGTGCGTCGTCGACGCATGGACTGAATTGTTGATGGCGAACTCCACC
ATCGGCAGGAATTTGCTTTAATTCGTAAAAGAATGGACTTTATCTCGAAGTATCTCCTCGAGGACACGATTGGCGCGTTCGGTCTGACCATCGGTTTCAG
GATGGTCAGACGTGGACATCTTTAAGCGCGTTCCGAGTGTTTTGAACGCTGAACGCCAGAGCTCATCTGTGAACCGCGGGTCCCGATCGGAAACGAGTTC
ACGAGGCAACCCATGAAGGCGAAAGACCGTGTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTAATTCAGATAGAGCAACCAGATGTACCATCTTG
CTGAACCTTTCAACGAACACAAGAATACCAGTATTCTTGTGAGAGCCTGCGGGGAATCCGAAGACAAAGTCCATTGAGACAGATTTCCAGCACTCGGCCG
GGATGGGCAGAGTCTGCAACGGGGCTCGAAGGGAAGGACTAGTCTTCACCCGTTGACATACCTCACAGGCCCGAACGTACTTGCGCAAGAACTGATACTG
GCGGCCAGTAAAAGTCGCGGCTCACTGTGAGATATGTTTTCTCACGACCACGATGTTCACCAATAGGTGCGTCGTGGTACTCATACATGATACGTAGTCG
TAGGTCACCATGATCTGGTACGACGACACGAGGCGTGTCGCCG