Description :
From Genome Similarity Track
Location :
scaffold_353:285- 6194
Transcript NameFunction/comments
Pl_105726hypothetical protein PHYSODRAFT_294855
Pl_105727acetolactate synthase, mitochondrial precursor
Pl_105728hypothetical protein PITG_11973
Pl_105729hypothetical protein PHYSODRAFT_360673

Sequence
5909 bases(100 bases per row)
GTGTCAAGGGAACGCTGGACGTCCTCGACGCCAAGTTCGAGGTTGTGGAGCTGGACACGCGCGACGATGGCGCTGAGATCCAAGCGCTGCTGCTGGAGCT
CACGGGCCAACGCACTGTGCCCAATGTCTTCATCAATGGCAAGCACATTGGAGGCTGCGACTCAGTGATGGAACTACATGCTAAGAGTGAGCTGGTGCCC
ATGCTCGAGGACTGAGCTGAGGACTATGACGGCTGTTTAATGGACACTGTTACGTCAAGCACTATGGGATTCTTATGGTTACCTACTTGCTTGCTGTCGT
TTGACTGATTTGTTTACACCGAGGTGGTTCCAGGGCAATCGTCGAAGTCGCCGATAATCATTTCGTCCAGCGAACGACCTGCTCCAACCATGGGATAGCA
GTGCTCGTTCTTCTCGACCATAAACTCTCCTAAGATGGGGCCCTCGGCAGCGAGGAACCGAGCCATGTCCTCCTCTAGAGTGTCTTCCTCTGAGCAGCGG
AACGCCTCGCAGTTCATCGCTTCGGCGAACTTGACGAAGTCCGGGTTGTTCATCTTGGTGCCAGAATACCGCTCCTCGTAGAACAGGTCCTGCCACTGCT
TGACCATACCCTGGAAGTTGTTGTTGAGCAGAAGCACCTTCACGCCAATGTTAAACTCGGCAGCAGTCGCCATCTCGCAAAGCGTCATGGAAAAACTGGC
ATCCCCGTCGATATCAACGACCACACTGTCAGGCTTAGCTGCCTTGGCGCCAATGGCCGAGGGAAGACCAAAGCCCATCGTACCCAGACCACCAGAGGTG
ATCAGCGTGTTCGGGTGCGACCACCGGTAGAACTGAGCAGCCCACATCTGGTGCTGACCCACACCCGTGGTGATCAGCACATCGTCACGGCCCTTGGTCT
GCTTGTACAGCTCCTCAATAACACGCTGAGCCTTCATAGGTGCGCCAGGGGCTGCAGGACGGTAGCGGAAGGGATACCTTGTCTTCCATCCCTGAAGCTT
CTTGTGCCACTCAGTTCGCGGTTTGGTCTCAATCTTCGGGAGGATCTGCTGCAAGTTATACTTGGTGTCACCAAGCACAGCCACGTCGGCAGGCACGATC
TTACCCACTTGCTTGCCCGTGATCTCGAAGTGGATGATACCACCACGTCCCTCAGCAGAAGCACGACGTGCTTCACGCGCGAAGTCGGGTACGCGGCCCG
TCACGCGGTCATCGAATCGTGCGCCAAGCGTGATGATGCAGTCAGCATCTTGCATGGCCTTGTTGGCGTACACCGATCCGTGCATGCCCAGCATGTGCAG
ACTCAGCGAGTCACGCTCGTCAAAGGCACCCATGCCTTGCAGCGACGTAGTCACAGGGATGTTAGCCTGACGTGCAAGGGCACGAAGCTCCTCGCTAGCG
TGCTGTGCACCAGCACCAGCGAAAATCAGTGGCTTCTTGGCCTTATTGATCATCTTAACAGCAGCTGCCAAATTTGCGTCCTGGTTCACACGATTGCCTT
CGATCTTCTTTTCACCATAGTATCCCAGCAGCTGCGGCTCAGTGACAACAGGGCTTTTGCAGAGTCCAGCCGTGATATCCTTGGGCAGATCCACGAGCAC
GGGACCAGGACGACCAGTCGTAGCAATGTGGAAGGCTTCACGGATGTTACGCGCCAAGTCGCGTACATCACGAACCTGCACGTTCCACTTGGTGCATGGA
CGAGTAATACCCAAAATGTCAGCTTCCTGGAAGGCGTCCGTGCCCAGCACCTGAGTAGCCACTTGACCACTAAAGACTACAATAGGGGTGCCGTCCATCA
GTGCGTCCTGCAGAGGTGTGACAGTGTTGGTAGCTCCAGGTCCAGACGTCACCAGCACAACACCAGGTTTGCCAGTAGCGCGGGCATAGCCCTGTGCCAT
GTGCCCGGCGCCCTGCTCGTGTCTCGTGAGGATAAAGTCAAAGTGTTCACTCTCATGAATCGCGTCAAACACCGGAAGGATGGCACCACCAGGGTAGCCG
AAGACGCAGTCCACGTCCATCTCGGCCAGAGTCTCGTGGAAGATCTCGGCGCCGGTCTTGCCCACAAACTTGTCCGTGCTCTTGGGCGGCGAGCGCTTGT
GCTCTTCCTGCGCCTTGGTCGTGGACAGCTCGCGCGCATTGTCCAGCGCGGCGGTCGCAGGCGTCTGCAGGCCACGCGCAGCGGACGACAAGGAGCGACG
GACTTGCTGCTCCTTGGAGGCGGCGCGCAACGCGCGGGACAGCTGGCGGGCTCTCAACATTAGTCTGCAGGGCTCCGCGAATCTCGATCTGAGGAGCTGC
TCGACACACCAGAACGCGTGCATAGACGCCACGTGACTGCGCAAACGGACTTCAAGCAGTTTGCGCAAGTTTTGCTTGGTGTGGAAAACACGACGTCCTA
GCCACAAGAAAGCGGCTGTGCAAGATCGGGGAATTGCGAAGATAGCCACAGGTTGATTACTGCAGTAGGAATAGTTGTTGGTGTTATTTCGATGAGAAAG
GAGATTGAGTTACCTTATCTTAGTAAAATGCGCATGACACATTGGTACTACCATTGCGCTGTACAATGGTTCCCCGATCATCTTTAAAGACGAGAAGATG
AGTAAAACAAGTACTTGAGTTGGTGGAACCCAGATCGTTTATAGCAAATAATAGCAACGGTCCATGAATAGAGAAGAGTGTTTTCAATGCTGTATTGATA
AAACGTTGAAATTATTTGAGCAACATTCCGCCGATCCCGGCTGTGGGGGACAAAGTGCCAGAGATGCATGAGCAAGTAGTCGAGATTCAAAGCCTTACCA
TATACCCCTGACAAAAAGATCTTTTGTTTCTGGAATAGCCCCGCAAATAAACCAATTATGGTAGTTGTGTTTGCCCAGTGCGCAATCTACGCTGTTGTCA
CCACGCAACATCGATTCATATACAGAAGATTTGCATACTTCCAACACGGTGACGGAAATACAATAGTTTACATGTTCGCGTCGCCAAATTATACCTGCGC
TAGTCTCAGTTGTACATTATCTAGCTGAGCGCAGTAAGTATCCCCTTCAATACTTTACTTACTTCGAAGTCCGAAGCCATAGCTGCAAGTTTACACTGAT
TATTATAAGTAGTTCCTTATCGATCGTGTGTCCCCGTAAATCTCATTTTGCAATTTCTCCTCCGCACTCAAGTAAAACGATGCTCCTCCACTACCTGGTC
GACTTTGTATTCCTCGCCTCTCTCGTATTAACGTTAACTGAAGCTGATTCATCGGTGACGGGTACCAAAGTACACAAATTTCTCGTTTTTTCAGCAGGGC
TGGATTCCACAGTGACGCTGCTCTATCCGTCTCTAGATTATTAAGAAATGGCGGTATTACTAACGAGCAAGACACGTCAGAGAGAGGTAGACTCTCTGTA
TTTGCAATCGAAAAATTTAAGATCGTGTTCACATCTTCGAAAGTAACTCCAGAACAGCTTCAGAGTTGGCTTAATAATGGGAAATCGGCAGAAATTGTCT
TTATGCGCTTGCACCTGCATCAGGCTGGAAAATGGTTGTTCGACAATCCCTAGTTTGCTTTCTGGATTCAATACACCGACGACTTGAGTGCCAAATATCC
CATTAAAAACTGTCTGCGTTTTCGACACTAATTCCTTAGTACGGCGATTATGCTTAGTGCAAAATGATCAAAGCAGCCAAAAGGTCATGTCATTGCCTGT
CAGCGCTTTATACGATTTTTTCCAGTAGTGAGTGACGGATGCATCAGCGCCTCGCGTTGCCTTTGCCGCGTTGGACAGCTGCCTGCCGTTTACCGCCACG
TTTCGCGAGTCTTGCAGCGTATGCAACTTTGGCGTCAGCACGTCTTTGAGCTTCATCTGCTCGACGCTGTCGCTCATTCTCAAGTCGAAGCTCCTCGCTC
ACGAACCAGTGCATCCACTCATCTTCGTACTTCATGATCATGCGCTCGTCGACCTCACGTTGCTGTTCTAGACGTCGTCTCTCAGCTTCACGGGCAATTT
CTCTCTCAATATGTCGCTGTTGCGTTTCCTCCATCTCCATCTGTAAATTCGCACGGATTTCACGCTTAAAGTCTCGTGCACGTGCCAAGAAAGCGCGACT
ACGTGCACTAATCACTTCAAACGGTGCTCGTACTTGTTTTCTCTCGTCTATCAATCCCGCAGTTTTAGCTTCACACTCAAGGCGAAAGCGCTGGGCTGGT
GATGGACGTTTTGTAGTGTTTTGATTACCCATTTTCTTCTTGTTCATTGCAGCGACAAGGGCTTCAGCGTGAACGTCAAGTACTTCCGGTCGGCGGGCCA
GGCCCGATTTTGCCTCGATATTGAAGGCACGAAGCAGTGCGGCGTCATCGACCGAGTACTCTGCTTGTTCAGCTTCCCAGGCGTCAGCATATTCACGTTC
CAGTGTTGCAATACTCGTGCTATCGCGCTGGATTGGGGAGTGCGAAATGACATGACGCAAATCCGTTAGGGCGGATGGAAGCTGCCCAAGACCGCAATAT
GCCTCGGCACGACACAAAAAGAACTGAATGCTGGTCTCAGGAATGGCTGGTACTTGTTCAGATTCATCGTCAGCATTGACTGCTTGCTGGTTGTCTATGC
CCTCGGATTCTGAAAGTGGAGCGTGAACATGTCGTATTGCTTTTGTCAGGTTGTCGATAGCATCAGGATATTGATGCAACGCCATATGAACGAGTCCTTT
GAGATAGTATGCTGTGGCGAGTTCAGTACATTCCAACTTGATAGCCTCGTGCAGATCCTCCAACGCTCCATTTGCAAACTTTTGGAAATCTTGCCTCGCT
TGAGCACGTCTGGATACAGATACTGTGTATGTTTCCCTGGTTGAGTCTTCAGGTTGAGCATCATTATTGTCTGACAGGTGGTATGTCGGAGATTCCGGTC
GTTCCTCGTGAACTATATTTTGCTTTGCTTTCAGTCGAAGTTTGCGAGCGCAAACCAGTTCAACTCCATGCATTTCTTGCTCACATGAACTAACAACTGT
AGTAACTTCCTCAATCACTTTTCTTGCTCTCTTTAGCTGCGAATGCACACAATCAACGAGTTAATGAAACGATGTTCGAATGAACACAGGTAAGCAGACA
ACGTACCAGCATATAACGACACAATCCGCGTTTGTAGTGTAGTAGAGGGTTCTGGCGATTTTGCTCAACAAAGGGAAGTGTCTTCACTTCAGTAATCAAC
TTCGTCAAGAGTTCTTCGGCTTTGTCAAACTCTCCAGCATCAACAAATTTTAACGCAAAAGCGAGATGATCTCGGCGATCCTGTTGGCGCTGGAGATGTT
GAGCAGTGAACGGGTTGTTAGAAAAATCACAGAAGCATTTCACGTAAAAGACTGCTGGAGGTGGTGCCGATAGAAGATTGTCGTTGGCATATAGGGATTG
CAGCTGGATCAATTCCATTAGAGATGTTGGTAATGTGCGGAGCCGATTGAACGCTATGTTCAATTTGGTCAGCTGAATCAGGCTACCCAAGCGTAGTGGT
AATCGCCTCAGTTGATTGTGGTCGCATTTCAACTGTCGTAGGTGAGGAAGCTGGGTAAGTTCGTCTGGTAGTTCTTGAAGCGCATTTGTACTGAGATACA
AGACCTCTAGTCGTCGAAGGTGAGCGATTTCAGTTGGGAGTACACGCAGGGAATTGTTCGAGAGATCTAAACGCTGCAGCTGGCTGCAGTACAGCAGCAC
TGCTAAAGGTACTTGAGTAAGGTAGTTGTCAGACAGCACAAGCTCCTGCAGCGTATCTTGCATGGACGTATGACCTATGAGCAATGGAAACTCCTGCAAA
GCATTCTGACGCAGCCGAAGCGTTTGGACTGGTGAGTCTTTGAGAAAGTCCAACGACTCGAACGTGACAATTCCACACGACGACGCGGAGAAGAAGGAAA
CGTTTGGGA