Description :
From Genome Similarity Track
Location :
Scaffold_1738:285- 3876
Sequence
3591 bases(100 bases per row)
CGGAAGCTGAGCAAGTCTGCTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGA
GGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGACCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CGCCTCAGCTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAT
GAGCTGTTGGAGGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGACCAGCGGTTTTTGGGTAGTTACTATGACGGATTGAGCTCGCGCGATAT
CCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTAAGATTGAAGAACGCATCCCAGATCTACCAACGTCTAATCGAAAACGCTCT
CTATGGATTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATACTGGA
ACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTATGCGAAAGAGTGACATCCCTGCTGAAGG
CGTGTACTAAGTGGAATCTCTCTATCCGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGA
GGCGAATCCTAAGGACCTATCTTCGTTAGCCGATCTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGTGCAGTTTGAACTACTACAGTCGG
TTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATACAAC
AAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAGCG
GAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGAAATTGAGGAAC
AGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTAC
AAGAACATAAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCT
CCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGG
TTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAAGCTTGG
CCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGACGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCTATCCCGACGGC
ACAGGCAGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGA
TGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGAC
AAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACG
GCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCT
TTACGGAATCAATGTGGTATTGAAGTGGAGAGGGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGA
AAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGA
GCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGGGTCGGGAGGATACCAAATCC
TACAGTATGGTTGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGGGATGGATTGATGA
GGCTGGTGATGCCAGAAACCTTATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGGCCTACCAACGGATCCGAGAAT
GTTTCCACTGGAGGGGACTAATCAAGAGCGTGCAACGGTAAGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTC
ACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATT
TGGGTGGACCTGTTTACCGGGTACACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAATGTGTCTTCCGAAG
ATTTGGAGCTAGCGAGATGATTCGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCA
ACCATGGCATATCGTTCCCAAGCTAACGGGTCGGCCTAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCTAGGATTTGGATCAGAGGG
ATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCC
CAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAA
GCTAGATCCCAGGTGAACGAACGACTGCGGAGTACGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCCCATCAAATCCAAG